Incidental Mutation 'R4916:Hmcn2'
ID 380026
Institutional Source Beutler Lab
Gene Symbol Hmcn2
Ensembl Gene ENSMUSG00000055632
Gene Name hemicentin 2
Synonyms
MMRRC Submission 042518-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4916 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 31204427-31350750 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 31250992 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 818 (V818D)
Ref Sequence ENSEMBL: ENSMUSP00000154649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113532] [ENSMUST00000226996]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000113532
AA Change: V818D

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109160
Gene: ENSMUSG00000055632
AA Change: V818D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
VWA 37 211 1.21e-1 SMART
Blast:IG_like 263 340 2e-38 BLAST
IG 434 515 7.36e-2 SMART
IGc2 530 595 1.91e-9 SMART
IGc2 621 685 4.81e-15 SMART
IGc2 711 773 1.09e-13 SMART
IGc2 799 866 2.72e-14 SMART
IGc2 894 959 1.95e-15 SMART
IGc2 985 1049 5e-13 SMART
IGc2 1082 1147 1.09e-13 SMART
low complexity region 1151 1169 N/A INTRINSIC
IGc2 1173 1232 7.07e-13 SMART
IGc2 1260 1326 4.31e-17 SMART
IGc2 1354 1428 3e-16 SMART
IGc2 1456 1522 1.82e-15 SMART
IGc2 1550 1615 2.7e-18 SMART
IGc2 1644 1708 1.3e-11 SMART
IGc2 1736 1801 6.69e-14 SMART
IG 1826 1917 2.31e0 SMART
IGc2 1932 1997 4.62e-17 SMART
IGc2 2024 2091 3.25e-12 SMART
IGc2 2117 2182 1.28e-10 SMART
IGc2 2209 2276 3.76e-8 SMART
IGc2 2305 2370 2.6e-11 SMART
IGc2 2399 2464 1.32e-12 SMART
IGc2 2492 2557 2.06e-14 SMART
IGc2 2588 2653 3.9e-15 SMART
IGc2 2686 2751 2.64e-12 SMART
IGc2 2797 2862 9.05e-11 SMART
IGc2 2892 2957 4.7e-9 SMART
IGc2 2984 3049 1.44e-13 SMART
IGc2 3079 3144 9.33e-13 SMART
IGc2 3171 3236 3.79e-13 SMART
IGc2 3264 3331 1.85e-16 SMART
IGc2 3360 3425 9.61e-15 SMART
low complexity region 3433 3445 N/A INTRINSIC
IGc2 3453 3514 5.83e-14 SMART
IGc2 3542 3600 1.76e-8 SMART
low complexity region 3613 3627 N/A INTRINSIC
IGc2 3628 3693 5.2e-11 SMART
IGc2 3719 3784 2.64e-12 SMART
IGc2 3810 3877 3.35e-5 SMART
IGc2 3903 3968 3.73e-12 SMART
IGc2 3994 4058 4.39e-9 SMART
IGc2 4084 4149 1.79e-14 SMART
low complexity region 4157 4169 N/A INTRINSIC
IGc2 4175 4238 9.33e-13 SMART
IGc2 4265 4329 7.22e-19 SMART
IGc2 4355 4419 1.59e-15 SMART
Pfam:G2F 4431 4613 1.7e-56 PFAM
EGF_CA 4668 4708 5.78e-11 SMART
EGF_CA 4709 4753 9.39e-11 SMART
EGF_CA 4754 4796 7.69e-7 SMART
EGF_CA 4797 4837 2.19e-11 SMART
EGF_CA 4904 4943 6.74e-12 SMART
EGF_like 4944 4989 1.87e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226996
AA Change: V818D

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930595D18Rik G A 12: 111,141,369 (GRCm39) Q19* probably null Het
6030468B19Rik T A 11: 117,697,092 (GRCm39) C230* probably null Het
Adcy10 A G 1: 165,345,815 (GRCm39) E288G probably damaging Het
Adnp T A 2: 168,029,537 (GRCm39) T51S possibly damaging Het
Agap3 C A 5: 24,683,011 (GRCm39) A464D probably damaging Het
Ago4 A C 4: 126,400,635 (GRCm39) C693G probably damaging Het
Ahi1 A G 10: 20,860,303 (GRCm39) R675G probably damaging Het
Amigo1 T A 3: 108,094,981 (GRCm39) L160Q probably damaging Het
Ankrd35 T C 3: 96,591,438 (GRCm39) S575P probably benign Het
Ano3 T A 2: 110,601,365 (GRCm39) T298S possibly damaging Het
Ap2b1 T G 11: 83,281,532 (GRCm39) F813V probably damaging Het
Aplnr T G 2: 84,967,261 (GRCm39) F95L probably damaging Het
Apobec2 T C 17: 48,730,153 (GRCm39) E171G probably benign Het
Ascc1 A G 10: 59,840,684 (GRCm39) N15S probably benign Het
AY358078 T A 14: 52,040,108 (GRCm39) Y73N unknown Het
B3gnt8 C A 7: 25,328,308 (GRCm39) P246Q probably damaging Het
C2cd2l T C 9: 44,227,857 (GRCm39) Q250R probably damaging Het
Camk2d T C 3: 126,577,624 (GRCm39) Y180H probably damaging Het
Ccdc170 A G 10: 4,468,971 (GRCm39) E167G probably damaging Het
Cdcp3 T A 7: 130,776,206 (GRCm39) probably null Het
Cdyl2 A G 8: 117,305,926 (GRCm39) M445T probably damaging Het
Clca3a1 T C 3: 144,721,605 (GRCm39) D322G probably benign Het
Cnot10 C T 9: 114,458,202 (GRCm39) M101I possibly damaging Het
Cntrl C T 2: 35,055,694 (GRCm39) T1196M probably benign Het
Cybb C G X: 9,316,989 (GRCm39) D246H probably benign Het
Dcaf6 T C 1: 165,247,774 (GRCm39) D153G probably damaging Het
Dennd2c G A 3: 103,039,140 (GRCm39) G96E probably benign Het
Dhrs9 T C 2: 69,231,752 (GRCm39) F304S probably damaging Het
Dmxl1 T C 18: 50,010,764 (GRCm39) S974P probably damaging Het
Dnah6 T C 6: 73,169,659 (GRCm39) probably benign Het
Dnah7c T C 1: 46,634,168 (GRCm39) L1049P probably damaging Het
Dnajc2 T C 5: 21,962,338 (GRCm39) K621E probably damaging Het
Ehbp1 T C 11: 22,096,592 (GRCm39) D299G probably benign Het
Erap1 A G 13: 74,794,647 (GRCm39) E102G probably benign Het
Fasn T G 11: 120,707,472 (GRCm39) N799T probably benign Het
Fbxl20 T C 11: 98,019,186 (GRCm39) D22G probably damaging Het
Fgfr1 T C 8: 26,053,542 (GRCm39) probably null Het
Frzb A T 2: 80,276,871 (GRCm39) I105N probably damaging Het
Gabrb1 T A 5: 72,026,764 (GRCm39) F55Y probably damaging Het
Gatd1 G T 7: 140,989,010 (GRCm39) C216* probably null Het
Gnl2 A C 4: 124,937,485 (GRCm39) N255T probably damaging Het
Golgb1 A T 16: 36,736,480 (GRCm39) Q1909L probably benign Het
Gpnmb T C 6: 49,028,904 (GRCm39) L474P probably damaging Het
H60b T C 10: 22,163,115 (GRCm39) V230A possibly damaging Het
Irag2 C A 6: 145,111,027 (GRCm39) S277R probably damaging Het
Itprid1 C T 6: 55,955,175 (GRCm39) P928S possibly damaging Het
Jade2 G T 11: 51,707,909 (GRCm39) T768K probably benign Het
Kif28 T C 1: 179,530,085 (GRCm39) H692R probably benign Het
Kmt2b T C 7: 30,277,942 (GRCm39) N1634S probably damaging Het
Knop1 A G 7: 118,445,299 (GRCm39) W222R probably damaging Het
Map1b T C 13: 99,569,808 (GRCm39) D971G unknown Het
Mapk7 G T 11: 61,384,475 (GRCm39) T77K probably damaging Het
Mcm6 A G 1: 128,276,714 (GRCm39) L292P probably damaging Het
Megf8 T C 7: 25,039,089 (GRCm39) L900P probably benign Het
Meis1 G A 11: 18,831,776 (GRCm39) H421Y possibly damaging Het
Minar2 A T 18: 59,205,277 (GRCm39) I22F probably damaging Het
Mllt1 T C 17: 57,206,813 (GRCm39) T344A probably benign Het
Mta1 T A 12: 113,100,160 (GRCm39) S657T probably benign Het
Mtus1 C A 8: 41,453,838 (GRCm39) K998N probably damaging Het
Ncdn G A 4: 126,643,731 (GRCm39) L364F possibly damaging Het
Ndufb7 T C 8: 84,297,534 (GRCm39) L63P probably damaging Het
Nfix T C 8: 85,498,458 (GRCm39) I172V probably benign Het
Nos1 T C 5: 118,085,635 (GRCm39) probably null Het
Nrp1 C A 8: 129,229,285 (GRCm39) S921* probably null Het
Oma1 T C 4: 103,176,727 (GRCm39) probably null Het
Or3a1b A T 11: 74,012,705 (GRCm39) I197F probably benign Het
Or5b106 T A 19: 13,123,355 (GRCm39) I223L possibly damaging Het
Pcp2 T A 8: 3,675,534 (GRCm39) probably benign Het
Pdk4 T A 6: 5,489,157 (GRCm39) H250L possibly damaging Het
Phldb3 A G 7: 24,323,716 (GRCm39) H449R probably benign Het
Pip4k2c T C 10: 127,035,196 (GRCm39) T391A possibly damaging Het
Polrmt A G 10: 79,582,385 (GRCm39) M1T probably null Het
Ppfia2 G C 10: 106,597,978 (GRCm39) L180F probably damaging Het
Prkcg T G 7: 3,378,781 (GRCm39) Y624* probably null Het
Psmg2 A G 18: 67,781,926 (GRCm39) E164G probably damaging Het
Rb1 A T 14: 73,454,131 (GRCm39) L589H probably damaging Het
Rcvrn A T 11: 67,586,591 (GRCm39) I117F probably damaging Het
Rere T A 4: 150,703,601 (GRCm39) W1528R probably damaging Het
Robo2 A G 16: 73,695,803 (GRCm39) S1447P possibly damaging Het
Scfd2 C A 5: 74,623,319 (GRCm39) G405W probably damaging Het
Scin T A 12: 40,119,373 (GRCm39) I552F possibly damaging Het
Serpina3k G A 12: 104,309,269 (GRCm39) V238M probably damaging Het
Slc1a6 G A 10: 78,632,085 (GRCm39) V304M probably damaging Het
Slc20a2 C T 8: 23,051,020 (GRCm39) S351L probably damaging Het
Slc31a2 T C 4: 62,215,325 (GRCm39) V124A probably damaging Het
Slc38a3 T C 9: 107,533,426 (GRCm39) N244S probably benign Het
Slc4a1 A G 11: 102,243,279 (GRCm39) V784A probably damaging Het
Slc6a5 T C 7: 49,598,004 (GRCm39) F623L probably benign Het
Slf2 T G 19: 44,960,100 (GRCm39) D1022E probably damaging Het
Slfn8 G A 11: 82,907,704 (GRCm39) H280Y probably damaging Het
Smpdl3a A T 10: 57,677,127 (GRCm39) D45V probably damaging Het
Ssh3 T C 19: 4,315,170 (GRCm39) E342G probably damaging Het
Tacr1 A T 6: 82,531,922 (GRCm39) I273F probably benign Het
Tfg T A 16: 56,514,759 (GRCm39) probably null Het
Tmem179 A G 12: 112,468,268 (GRCm39) L71P probably damaging Het
Tmem63a T A 1: 180,794,086 (GRCm39) I541N probably benign Het
Traj20 G A 14: 54,436,924 (GRCm39) probably benign Het
Trappc13 A T 13: 104,290,802 (GRCm39) probably null Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Tulp1 A G 17: 28,578,109 (GRCm39) L310P probably damaging Het
Ube3d A G 9: 86,304,925 (GRCm39) Y306H probably damaging Het
Urb1 A T 16: 90,580,216 (GRCm39) V649E probably damaging Het
Vps13d A G 4: 144,709,963 (GRCm39) L4211P probably damaging Het
Vwa5b1 T A 4: 138,321,573 (GRCm39) I407F possibly damaging Het
Vwce G T 19: 10,624,243 (GRCm39) C378F probably damaging Het
Zfp791 T A 8: 85,837,580 (GRCm39) I95L probably benign Het
Other mutations in Hmcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Hmcn2 APN 2 31,233,108 (GRCm39) missense probably damaging 1.00
IGL00966:Hmcn2 APN 2 31,319,006 (GRCm39) missense probably damaging 0.97
IGL00973:Hmcn2 APN 2 31,273,833 (GRCm39) intron probably benign
IGL01364:Hmcn2 APN 2 31,251,826 (GRCm39) nonsense probably null
IGL01486:Hmcn2 APN 2 31,226,633 (GRCm39) missense probably damaging 1.00
IGL01530:Hmcn2 APN 2 31,244,276 (GRCm39) missense possibly damaging 0.85
IGL01550:Hmcn2 APN 2 31,314,264 (GRCm39) missense possibly damaging 0.84
IGL01710:Hmcn2 APN 2 31,233,114 (GRCm39) missense probably damaging 1.00
IGL01764:Hmcn2 APN 2 31,295,642 (GRCm39) missense possibly damaging 0.93
IGL01924:Hmcn2 APN 2 31,288,929 (GRCm39) missense probably benign 0.00
IGL02003:Hmcn2 APN 2 31,318,994 (GRCm39) missense possibly damaging 0.90
IGL02117:Hmcn2 APN 2 31,347,185 (GRCm39) missense possibly damaging 0.75
IGL02205:Hmcn2 APN 2 31,290,139 (GRCm39) missense probably damaging 1.00
IGL02273:Hmcn2 APN 2 31,314,389 (GRCm39) missense probably benign 0.06
IGL02313:Hmcn2 APN 2 31,343,617 (GRCm39) missense possibly damaging 0.68
IGL02326:Hmcn2 APN 2 31,340,964 (GRCm39) missense probably damaging 0.97
IGL02486:Hmcn2 APN 2 31,310,107 (GRCm39) missense probably damaging 0.98
IGL02551:Hmcn2 APN 2 31,344,823 (GRCm39) missense possibly damaging 0.83
IGL02695:Hmcn2 APN 2 31,298,985 (GRCm39) missense possibly damaging 0.87
IGL02725:Hmcn2 APN 2 31,295,540 (GRCm39) missense probably damaging 1.00
IGL02792:Hmcn2 APN 2 31,236,602 (GRCm39) missense probably damaging 1.00
IGL02882:Hmcn2 APN 2 31,303,379 (GRCm39) nonsense probably null
IGL03003:Hmcn2 APN 2 31,323,498 (GRCm39) missense probably damaging 0.98
IGL03067:Hmcn2 APN 2 31,236,642 (GRCm39) missense probably damaging 1.00
IGL03137:Hmcn2 APN 2 31,252,242 (GRCm39) missense probably damaging 0.98
IGL03220:Hmcn2 APN 2 31,236,633 (GRCm39) missense possibly damaging 0.94
IGL03411:Hmcn2 APN 2 31,236,649 (GRCm39) missense possibly damaging 0.83
PIT4544001:Hmcn2 UTSW 2 31,318,262 (GRCm39) missense probably damaging 0.98
R0044:Hmcn2 UTSW 2 31,302,520 (GRCm39) missense probably damaging 0.98
R0044:Hmcn2 UTSW 2 31,302,520 (GRCm39) missense probably damaging 0.98
R0048:Hmcn2 UTSW 2 31,318,249 (GRCm39) missense possibly damaging 0.92
R0048:Hmcn2 UTSW 2 31,318,249 (GRCm39) missense possibly damaging 0.92
R0078:Hmcn2 UTSW 2 31,278,356 (GRCm39) missense probably damaging 1.00
R0090:Hmcn2 UTSW 2 31,316,210 (GRCm39) missense probably damaging 1.00
R0173:Hmcn2 UTSW 2 31,328,343 (GRCm39) critical splice donor site probably null
R0257:Hmcn2 UTSW 2 31,259,176 (GRCm39) splice site probably benign
R0266:Hmcn2 UTSW 2 31,335,365 (GRCm39) splice site probably benign
R0266:Hmcn2 UTSW 2 31,284,839 (GRCm39) missense probably benign 0.03
R0326:Hmcn2 UTSW 2 31,313,237 (GRCm39) nonsense probably null
R0366:Hmcn2 UTSW 2 31,314,218 (GRCm39) missense possibly damaging 0.88
R0400:Hmcn2 UTSW 2 31,290,141 (GRCm39) missense probably damaging 0.98
R0412:Hmcn2 UTSW 2 31,278,259 (GRCm39) missense probably damaging 0.98
R0436:Hmcn2 UTSW 2 31,295,624 (GRCm39) missense probably damaging 1.00
R0457:Hmcn2 UTSW 2 31,305,296 (GRCm39) critical splice donor site probably null
R0487:Hmcn2 UTSW 2 31,276,689 (GRCm39) missense possibly damaging 0.60
R0568:Hmcn2 UTSW 2 31,305,248 (GRCm39) missense probably benign 0.02
R0755:Hmcn2 UTSW 2 31,343,172 (GRCm39) missense probably damaging 0.99
R0811:Hmcn2 UTSW 2 31,310,383 (GRCm39) missense probably damaging 0.99
R0812:Hmcn2 UTSW 2 31,310,383 (GRCm39) missense probably damaging 0.99
R0964:Hmcn2 UTSW 2 31,281,523 (GRCm39) missense probably benign 0.23
R0988:Hmcn2 UTSW 2 31,225,463 (GRCm39) missense probably damaging 1.00
R1484:Hmcn2 UTSW 2 31,236,507 (GRCm39) missense probably damaging 1.00
R1509:Hmcn2 UTSW 2 31,204,491 (GRCm39) missense possibly damaging 0.86
R1535:Hmcn2 UTSW 2 31,310,419 (GRCm39) missense possibly damaging 0.91
R1574:Hmcn2 UTSW 2 31,294,899 (GRCm39) missense probably damaging 0.97
R1574:Hmcn2 UTSW 2 31,294,899 (GRCm39) missense probably damaging 0.97
R1600:Hmcn2 UTSW 2 31,320,799 (GRCm39) missense probably damaging 0.98
R1623:Hmcn2 UTSW 2 31,348,051 (GRCm39) missense possibly damaging 0.84
R1692:Hmcn2 UTSW 2 31,340,856 (GRCm39) missense possibly damaging 0.47
R1719:Hmcn2 UTSW 2 31,244,733 (GRCm39) missense probably damaging 1.00
R1747:Hmcn2 UTSW 2 31,347,997 (GRCm39) missense probably benign 0.00
R1756:Hmcn2 UTSW 2 31,286,132 (GRCm39) missense probably damaging 0.99
R1763:Hmcn2 UTSW 2 31,204,602 (GRCm39) missense probably damaging 1.00
R1815:Hmcn2 UTSW 2 31,283,055 (GRCm39) missense probably damaging 0.97
R1822:Hmcn2 UTSW 2 31,273,704 (GRCm39) missense probably damaging 0.99
R1858:Hmcn2 UTSW 2 31,305,295 (GRCm39) critical splice donor site probably null
R1895:Hmcn2 UTSW 2 31,295,647 (GRCm39) missense probably damaging 0.99
R1908:Hmcn2 UTSW 2 31,301,922 (GRCm39) critical splice donor site probably null
R1946:Hmcn2 UTSW 2 31,295,647 (GRCm39) missense probably damaging 0.99
R1966:Hmcn2 UTSW 2 31,279,341 (GRCm39) missense probably damaging 0.99
R2007:Hmcn2 UTSW 2 31,328,267 (GRCm39) missense possibly damaging 0.91
R2050:Hmcn2 UTSW 2 31,225,448 (GRCm39) missense probably damaging 1.00
R2055:Hmcn2 UTSW 2 31,268,294 (GRCm39) missense probably benign 0.33
R2097:Hmcn2 UTSW 2 31,270,431 (GRCm39) missense probably damaging 1.00
R2145:Hmcn2 UTSW 2 31,223,943 (GRCm39) splice site probably benign
R2155:Hmcn2 UTSW 2 31,350,361 (GRCm39) missense possibly damaging 0.68
R2170:Hmcn2 UTSW 2 31,270,293 (GRCm39) missense probably benign 0.08
R2188:Hmcn2 UTSW 2 31,309,947 (GRCm39) missense probably benign 0.14
R2208:Hmcn2 UTSW 2 31,270,309 (GRCm39) missense probably damaging 1.00
R2217:Hmcn2 UTSW 2 31,240,586 (GRCm39) missense probably benign 0.02
R2407:Hmcn2 UTSW 2 31,225,424 (GRCm39) critical splice acceptor site probably null
R2764:Hmcn2 UTSW 2 31,278,310 (GRCm39) missense probably damaging 0.98
R2913:Hmcn2 UTSW 2 31,350,222 (GRCm39) missense possibly damaging 0.68
R2986:Hmcn2 UTSW 2 31,251,010 (GRCm39) missense probably damaging 1.00
R3157:Hmcn2 UTSW 2 31,290,267 (GRCm39) missense probably damaging 0.99
R3406:Hmcn2 UTSW 2 31,323,284 (GRCm39) splice site probably benign
R3429:Hmcn2 UTSW 2 31,299,156 (GRCm39) missense possibly damaging 0.87
R3737:Hmcn2 UTSW 2 31,226,624 (GRCm39) nonsense probably null
R3739:Hmcn2 UTSW 2 31,226,624 (GRCm39) nonsense probably null
R3771:Hmcn2 UTSW 2 31,250,908 (GRCm39) missense probably damaging 0.99
R3772:Hmcn2 UTSW 2 31,250,908 (GRCm39) missense probably damaging 0.99
R3773:Hmcn2 UTSW 2 31,250,908 (GRCm39) missense probably damaging 0.99
R3804:Hmcn2 UTSW 2 31,242,897 (GRCm39) splice site probably null
R3837:Hmcn2 UTSW 2 31,303,419 (GRCm39) missense probably damaging 0.99
R3838:Hmcn2 UTSW 2 31,303,419 (GRCm39) missense probably damaging 0.99
R3846:Hmcn2 UTSW 2 31,320,362 (GRCm39) missense possibly damaging 0.51
R3925:Hmcn2 UTSW 2 31,343,169 (GRCm39) missense probably benign 0.00
R3934:Hmcn2 UTSW 2 31,270,496 (GRCm39) critical splice donor site probably null
R3946:Hmcn2 UTSW 2 31,272,406 (GRCm39) missense possibly damaging 0.91
R4035:Hmcn2 UTSW 2 31,226,624 (GRCm39) nonsense probably null
R4057:Hmcn2 UTSW 2 31,290,250 (GRCm39) missense probably damaging 1.00
R4583:Hmcn2 UTSW 2 31,303,277 (GRCm39) missense possibly damaging 0.84
R4623:Hmcn2 UTSW 2 31,286,722 (GRCm39) missense probably damaging 1.00
R4647:Hmcn2 UTSW 2 31,289,031 (GRCm39) missense possibly damaging 0.82
R4668:Hmcn2 UTSW 2 31,325,804 (GRCm39) missense probably benign 0.40
R4669:Hmcn2 UTSW 2 31,325,804 (GRCm39) missense probably benign 0.40
R4687:Hmcn2 UTSW 2 31,328,297 (GRCm39) missense probably benign 0.14
R4735:Hmcn2 UTSW 2 31,273,787 (GRCm39) missense probably benign 0.06
R4772:Hmcn2 UTSW 2 31,335,326 (GRCm39) missense probably benign 0.02
R4866:Hmcn2 UTSW 2 31,279,403 (GRCm39) missense possibly damaging 0.88
R4943:Hmcn2 UTSW 2 31,225,504 (GRCm39) missense probably damaging 1.00
R4967:Hmcn2 UTSW 2 31,244,176 (GRCm39) critical splice acceptor site probably null
R4973:Hmcn2 UTSW 2 31,234,108 (GRCm39) missense probably benign 0.15
R4975:Hmcn2 UTSW 2 31,283,037 (GRCm39) missense possibly damaging 0.88
R4994:Hmcn2 UTSW 2 31,348,067 (GRCm39) critical splice donor site probably null
R4997:Hmcn2 UTSW 2 31,291,720 (GRCm39) missense probably damaging 1.00
R5045:Hmcn2 UTSW 2 31,299,093 (GRCm39) missense probably damaging 1.00
R5117:Hmcn2 UTSW 2 31,348,061 (GRCm39) missense possibly damaging 0.95
R5151:Hmcn2 UTSW 2 31,279,455 (GRCm39) missense probably null
R5232:Hmcn2 UTSW 2 31,347,760 (GRCm39) missense probably damaging 0.99
R5237:Hmcn2 UTSW 2 31,304,728 (GRCm39) missense probably benign 0.01
R5288:Hmcn2 UTSW 2 31,350,333 (GRCm39) missense probably benign 0.11
R5375:Hmcn2 UTSW 2 31,320,453 (GRCm39) missense possibly damaging 0.92
R5379:Hmcn2 UTSW 2 31,299,023 (GRCm39) missense probably damaging 0.99
R5385:Hmcn2 UTSW 2 31,350,333 (GRCm39) missense probably benign 0.11
R5412:Hmcn2 UTSW 2 31,236,629 (GRCm39) missense possibly damaging 0.77
R5426:Hmcn2 UTSW 2 31,226,556 (GRCm39) missense possibly damaging 0.95
R5434:Hmcn2 UTSW 2 31,310,375 (GRCm39) missense probably damaging 1.00
R5441:Hmcn2 UTSW 2 31,296,428 (GRCm39) missense possibly damaging 0.82
R5484:Hmcn2 UTSW 2 31,283,066 (GRCm39) nonsense probably null
R5492:Hmcn2 UTSW 2 31,310,318 (GRCm39) missense probably benign 0.03
R5572:Hmcn2 UTSW 2 31,304,538 (GRCm39) critical splice acceptor site probably null
R5572:Hmcn2 UTSW 2 31,304,537 (GRCm39) critical splice acceptor site probably null
R5591:Hmcn2 UTSW 2 31,234,059 (GRCm39) missense probably damaging 1.00
R5614:Hmcn2 UTSW 2 31,318,315 (GRCm39) missense probably damaging 0.99
R5634:Hmcn2 UTSW 2 31,223,893 (GRCm39) missense probably damaging 1.00
R5645:Hmcn2 UTSW 2 31,310,824 (GRCm39) missense possibly damaging 0.92
R5716:Hmcn2 UTSW 2 31,348,750 (GRCm39) missense possibly damaging 0.68
R5716:Hmcn2 UTSW 2 31,226,579 (GRCm39) missense probably damaging 1.00
R5725:Hmcn2 UTSW 2 31,273,827 (GRCm39) critical splice donor site probably null
R5760:Hmcn2 UTSW 2 31,304,580 (GRCm39) missense possibly damaging 0.91
R5774:Hmcn2 UTSW 2 31,299,147 (GRCm39) missense possibly damaging 0.94
R5838:Hmcn2 UTSW 2 31,347,819 (GRCm39) missense probably damaging 0.99
R5899:Hmcn2 UTSW 2 31,244,685 (GRCm39) missense possibly damaging 0.93
R5916:Hmcn2 UTSW 2 31,286,151 (GRCm39) missense probably damaging 1.00
R5973:Hmcn2 UTSW 2 31,310,335 (GRCm39) missense probably damaging 0.99
R6002:Hmcn2 UTSW 2 31,310,321 (GRCm39) missense probably damaging 0.99
R6018:Hmcn2 UTSW 2 31,260,804 (GRCm39) missense probably benign 0.13
R6063:Hmcn2 UTSW 2 31,324,725 (GRCm39) missense probably benign 0.06
R6161:Hmcn2 UTSW 2 31,246,266 (GRCm39) missense probably benign
R6166:Hmcn2 UTSW 2 31,259,274 (GRCm39) missense probably damaging 1.00
R6177:Hmcn2 UTSW 2 31,310,118 (GRCm39) nonsense probably null
R6191:Hmcn2 UTSW 2 31,348,758 (GRCm39) missense probably damaging 0.99
R6195:Hmcn2 UTSW 2 31,274,127 (GRCm39) missense probably damaging 0.96
R6273:Hmcn2 UTSW 2 31,301,846 (GRCm39) missense probably damaging 0.99
R6293:Hmcn2 UTSW 2 31,225,463 (GRCm39) missense probably damaging 1.00
R6349:Hmcn2 UTSW 2 31,278,385 (GRCm39) missense probably damaging 1.00
R6395:Hmcn2 UTSW 2 31,259,269 (GRCm39) missense probably damaging 1.00
R6448:Hmcn2 UTSW 2 31,310,832 (GRCm39) missense probably benign 0.02
R6450:Hmcn2 UTSW 2 31,251,812 (GRCm39) missense probably benign 0.11
R6479:Hmcn2 UTSW 2 31,315,480 (GRCm39) missense probably damaging 0.99
R6502:Hmcn2 UTSW 2 31,272,490 (GRCm39) missense probably damaging 0.99
R6511:Hmcn2 UTSW 2 31,246,354 (GRCm39) missense possibly damaging 0.79
R6537:Hmcn2 UTSW 2 31,305,280 (GRCm39) missense probably benign 0.00
R6880:Hmcn2 UTSW 2 31,233,068 (GRCm39) missense probably damaging 1.00
R6924:Hmcn2 UTSW 2 31,240,517 (GRCm39) splice site probably null
R6971:Hmcn2 UTSW 2 31,322,333 (GRCm39) missense probably benign 0.02
R7057:Hmcn2 UTSW 2 31,312,661 (GRCm39) missense probably damaging 0.99
R7141:Hmcn2 UTSW 2 31,250,908 (GRCm39) missense probably benign 0.17
R7268:Hmcn2 UTSW 2 31,347,978 (GRCm39) missense possibly damaging 0.48
R7307:Hmcn2 UTSW 2 31,233,093 (GRCm39) missense probably damaging 0.96
R7322:Hmcn2 UTSW 2 31,349,093 (GRCm39) missense probably damaging 0.99
R7334:Hmcn2 UTSW 2 31,343,147 (GRCm39) missense possibly damaging 0.82
R7334:Hmcn2 UTSW 2 31,325,806 (GRCm39) missense probably damaging 0.98
R7335:Hmcn2 UTSW 2 31,282,169 (GRCm39) missense possibly damaging 0.88
R7358:Hmcn2 UTSW 2 31,306,824 (GRCm39) missense probably damaging 1.00
R7359:Hmcn2 UTSW 2 31,278,395 (GRCm39) missense probably benign 0.13
R7488:Hmcn2 UTSW 2 31,310,842 (GRCm39) missense probably damaging 1.00
R7498:Hmcn2 UTSW 2 31,273,487 (GRCm39) splice site probably null
R7560:Hmcn2 UTSW 2 31,347,185 (GRCm39) missense probably benign
R7566:Hmcn2 UTSW 2 31,344,869 (GRCm39) missense probably damaging 0.96
R7570:Hmcn2 UTSW 2 31,313,923 (GRCm39) missense probably benign
R7574:Hmcn2 UTSW 2 31,345,531 (GRCm39) missense possibly damaging 0.68
R7599:Hmcn2 UTSW 2 31,246,298 (GRCm39) missense possibly damaging 0.93
R7654:Hmcn2 UTSW 2 31,236,581 (GRCm39) missense probably benign 0.00
R7662:Hmcn2 UTSW 2 31,272,357 (GRCm39) missense probably benign 0.01
R7666:Hmcn2 UTSW 2 31,270,245 (GRCm39) missense probably damaging 1.00
R7698:Hmcn2 UTSW 2 31,313,165 (GRCm39) missense probably damaging 0.98
R7722:Hmcn2 UTSW 2 31,272,512 (GRCm39) nonsense probably null
R7739:Hmcn2 UTSW 2 31,348,038 (GRCm39) missense possibly damaging 0.48
R7749:Hmcn2 UTSW 2 31,343,045 (GRCm39) splice site probably null
R7828:Hmcn2 UTSW 2 31,295,887 (GRCm39) missense possibly damaging 0.95
R7912:Hmcn2 UTSW 2 31,310,311 (GRCm39) missense probably benign 0.00
R7978:Hmcn2 UTSW 2 31,279,359 (GRCm39) missense probably benign 0.40
R8075:Hmcn2 UTSW 2 31,279,403 (GRCm39) missense possibly damaging 0.88
R8088:Hmcn2 UTSW 2 31,316,915 (GRCm39) nonsense probably null
R8101:Hmcn2 UTSW 2 31,240,082 (GRCm39) missense probably benign 0.08
R8124:Hmcn2 UTSW 2 31,290,136 (GRCm39) missense probably benign 0.01
R8145:Hmcn2 UTSW 2 31,313,117 (GRCm39) missense probably damaging 1.00
R8230:Hmcn2 UTSW 2 31,234,485 (GRCm39) missense possibly damaging 0.91
R8267:Hmcn2 UTSW 2 31,349,191 (GRCm39) missense probably benign
R8277:Hmcn2 UTSW 2 31,259,189 (GRCm39) missense probably benign 0.16
R8307:Hmcn2 UTSW 2 31,286,127 (GRCm39) missense probably damaging 0.99
R8353:Hmcn2 UTSW 2 31,275,353 (GRCm39) splice site probably null
R8415:Hmcn2 UTSW 2 31,281,088 (GRCm39) missense probably benign 0.15
R8416:Hmcn2 UTSW 2 31,281,088 (GRCm39) missense probably benign 0.15
R8437:Hmcn2 UTSW 2 31,281,088 (GRCm39) missense probably benign 0.15
R8438:Hmcn2 UTSW 2 31,281,088 (GRCm39) missense probably benign 0.15
R8440:Hmcn2 UTSW 2 31,281,088 (GRCm39) missense probably benign 0.15
R8442:Hmcn2 UTSW 2 31,281,088 (GRCm39) missense probably benign 0.15
R8497:Hmcn2 UTSW 2 31,313,357 (GRCm39) missense possibly damaging 0.92
R8520:Hmcn2 UTSW 2 31,244,726 (GRCm39) missense probably damaging 1.00
R8530:Hmcn2 UTSW 2 31,281,088 (GRCm39) missense probably benign 0.15
R8537:Hmcn2 UTSW 2 31,281,088 (GRCm39) missense probably benign 0.15
R8550:Hmcn2 UTSW 2 31,240,654 (GRCm39) critical splice donor site probably null
R8721:Hmcn2 UTSW 2 31,315,189 (GRCm39) missense probably damaging 1.00
R8795:Hmcn2 UTSW 2 31,315,393 (GRCm39) missense probably benign 0.01
R8802:Hmcn2 UTSW 2 31,301,288 (GRCm39) missense probably damaging 0.97
R8804:Hmcn2 UTSW 2 31,315,393 (GRCm39) missense probably benign 0.01
R8805:Hmcn2 UTSW 2 31,315,393 (GRCm39) missense probably benign 0.01
R8904:Hmcn2 UTSW 2 31,323,404 (GRCm39) missense possibly damaging 0.92
R8937:Hmcn2 UTSW 2 31,204,427 (GRCm39) start codon destroyed probably benign 0.01
R8947:Hmcn2 UTSW 2 31,278,220 (GRCm39) missense probably damaging 0.99
R8948:Hmcn2 UTSW 2 31,244,741 (GRCm39) missense probably damaging 1.00
R8950:Hmcn2 UTSW 2 31,244,741 (GRCm39) missense probably damaging 1.00
R8959:Hmcn2 UTSW 2 31,282,159 (GRCm39) missense probably damaging 1.00
R9025:Hmcn2 UTSW 2 31,347,967 (GRCm39) missense possibly damaging 0.56
R9039:Hmcn2 UTSW 2 31,244,646 (GRCm39) missense probably damaging 0.97
R9068:Hmcn2 UTSW 2 31,303,685 (GRCm39) missense probably benign 0.01
R9161:Hmcn2 UTSW 2 31,242,758 (GRCm39) missense probably benign 0.02
R9178:Hmcn2 UTSW 2 31,281,521 (GRCm39) missense possibly damaging 0.77
R9204:Hmcn2 UTSW 2 31,278,377 (GRCm39) missense probably damaging 0.98
R9317:Hmcn2 UTSW 2 31,350,328 (GRCm39) missense possibly damaging 0.91
R9341:Hmcn2 UTSW 2 31,279,359 (GRCm39) missense probably benign 0.40
R9343:Hmcn2 UTSW 2 31,279,359 (GRCm39) missense probably benign 0.40
R9355:Hmcn2 UTSW 2 31,328,302 (GRCm39) missense probably benign 0.18
R9371:Hmcn2 UTSW 2 31,301,917 (GRCm39) missense probably damaging 1.00
R9450:Hmcn2 UTSW 2 31,316,845 (GRCm39) missense probably damaging 1.00
R9477:Hmcn2 UTSW 2 31,286,031 (GRCm39) critical splice acceptor site probably null
R9483:Hmcn2 UTSW 2 31,320,375 (GRCm39) missense
R9536:Hmcn2 UTSW 2 31,335,130 (GRCm39) missense possibly damaging 0.86
R9580:Hmcn2 UTSW 2 31,294,875 (GRCm39) missense probably benign 0.16
R9593:Hmcn2 UTSW 2 31,244,742 (GRCm39) missense probably damaging 0.99
R9649:Hmcn2 UTSW 2 31,292,450 (GRCm39) missense possibly damaging 0.95
R9706:Hmcn2 UTSW 2 31,305,279 (GRCm39) missense probably benign 0.00
X0066:Hmcn2 UTSW 2 31,344,823 (GRCm39) missense possibly damaging 0.83
X0067:Hmcn2 UTSW 2 31,295,879 (GRCm39) missense possibly damaging 0.82
Z1088:Hmcn2 UTSW 2 31,349,076 (GRCm39) splice site probably null
Z1088:Hmcn2 UTSW 2 31,271,079 (GRCm39) missense probably benign 0.01
Z1176:Hmcn2 UTSW 2 31,319,103 (GRCm39) missense probably damaging 0.97
Z1176:Hmcn2 UTSW 2 31,315,428 (GRCm39) missense probably damaging 1.00
Z1176:Hmcn2 UTSW 2 31,234,041 (GRCm39) missense possibly damaging 0.95
Z1177:Hmcn2 UTSW 2 31,316,836 (GRCm39) missense probably damaging 0.99
Z1177:Hmcn2 UTSW 2 31,234,518 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTCTAGAGATGACACAAAG -3'
(R):5'- TATGGGCCTGCATCAACCTG -3'

Sequencing Primer
(F):5'- CCTCTAGAGATGACACAAAGCAAAGG -3'
(R):5'- CCATGATGGTGATAGACTCTGACC -3'
Posted On 2016-04-15