Incidental Mutation 'R4916:Ano3'
ID 380032
Institutional Source Beutler Lab
Gene Symbol Ano3
Ensembl Gene ENSMUSG00000074968
Gene Name anoctamin 3
Synonyms Tmem16c, B230324K02Rik
MMRRC Submission 042518-MU
Accession Numbers

Genbank: NM_001081556, NM_001128103; MGI: 3613666

Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R4916 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 110655201-110950923 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 110771020 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 298 (T298S)
Ref Sequence ENSEMBL: ENSMUSP00000097219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099623]
AlphaFold A2AHL1
Predicted Effect possibly damaging
Transcript: ENSMUST00000099623
AA Change: T298S

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968
AA Change: T298S

DomainStartEndE-ValueType
Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111019
SMART Domains Protein: ENSMUSP00000106648
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoctamin 384 627 6.3e-60 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930595D18Rik G A 12: 111,174,935 Q19* probably null Het
5430419D17Rik T A 7: 131,174,477 probably null Het
6030468B19Rik T A 11: 117,806,266 C230* probably null Het
A730017C20Rik A T 18: 59,072,205 I22F probably damaging Het
Adcy10 A G 1: 165,518,246 E288G probably damaging Het
Adnp T A 2: 168,187,617 T51S possibly damaging Het
Agap3 C A 5: 24,478,013 A464D probably damaging Het
Ago4 A C 4: 126,506,842 C693G probably damaging Het
Ahi1 A G 10: 20,984,404 R675G probably damaging Het
Amigo1 T A 3: 108,187,665 L160Q probably damaging Het
Ankrd35 T C 3: 96,684,122 S575P probably benign Het
Ap2b1 T G 11: 83,390,706 F813V probably damaging Het
Aplnr T G 2: 85,136,917 F95L probably damaging Het
Apobec2 T C 17: 48,423,125 E171G probably benign Het
Ascc1 A G 10: 60,004,862 N15S probably benign Het
AY358078 T A 14: 51,802,651 Y73N unknown Het
B3gnt8 C A 7: 25,628,883 P246Q probably damaging Het
C2cd2l T C 9: 44,316,560 Q250R probably damaging Het
Camk2d T C 3: 126,783,975 Y180H probably damaging Het
Ccdc129 C T 6: 55,978,190 P928S possibly damaging Het
Ccdc170 A G 10: 4,518,971 E167G probably damaging Het
Cdyl2 A G 8: 116,579,187 M445T probably damaging Het
Clca1 T C 3: 145,015,844 D322G probably benign Het
Cnot10 C T 9: 114,629,134 M101I possibly damaging Het
Cntrl C T 2: 35,165,682 T1196M probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcaf6 T C 1: 165,420,205 D153G probably damaging Het
Dennd2c G A 3: 103,131,824 G96E probably benign Het
Dhrs9 T C 2: 69,401,408 F304S probably damaging Het
Dmxl1 T C 18: 49,877,697 S974P probably damaging Het
Dnah6 T C 6: 73,192,676 probably benign Het
Dnah7c T C 1: 46,595,008 L1049P probably damaging Het
Dnajc2 T C 5: 21,757,340 K621E probably damaging Het
Ehbp1 T C 11: 22,146,592 D299G probably benign Het
Erap1 A G 13: 74,646,528 E102G probably benign Het
Fasn T G 11: 120,816,646 N799T probably benign Het
Fbxl20 T C 11: 98,128,360 D22G probably damaging Het
Fgfr1 T C 8: 25,563,526 probably null Het
Frzb A T 2: 80,446,527 I105N probably damaging Het
Gabrb1 T A 5: 71,869,421 F55Y probably damaging Het
Gatd1 G T 7: 141,409,097 C216* probably null Het
Gnl2 A C 4: 125,043,692 N255T probably damaging Het
Golgb1 A T 16: 36,916,118 Q1909L probably benign Het
Gpnmb T C 6: 49,051,970 L474P probably damaging Het
H60b T C 10: 22,287,216 V230A possibly damaging Het
Hmcn2 T A 2: 31,360,980 V818D probably damaging Het
Jade2 G T 11: 51,817,082 T768K probably benign Het
Kif28 T C 1: 179,702,520 H692R probably benign Het
Kmt2b T C 7: 30,578,517 N1634S probably damaging Het
Knop1 A G 7: 118,846,076 W222R probably damaging Het
Lrmp C A 6: 145,165,301 S277R probably damaging Het
Map1b T C 13: 99,433,300 D971G unknown Het
Mapk7 G T 11: 61,493,649 T77K probably damaging Het
Mcm6 A G 1: 128,348,977 L292P probably damaging Het
Megf8 T C 7: 25,339,664 L900P probably benign Het
Meis1 G A 11: 18,881,776 H421Y possibly damaging Het
Mllt1 T C 17: 56,899,813 T344A probably benign Het
Mta1 T A 12: 113,136,540 S657T probably benign Het
Mtus1 C A 8: 41,000,801 K998N probably damaging Het
Ncdn G A 4: 126,749,938 L364F possibly damaging Het
Ndufb7 T C 8: 83,570,905 L63P probably damaging Het
Nfix T C 8: 84,771,829 I172V probably benign Het
Nos1 T C 5: 117,947,570 probably null Het
Nrp1 C A 8: 128,502,804 S921* probably null Het
Olfr1459 T A 19: 13,145,991 I223L possibly damaging Het
Olfr401 A T 11: 74,121,879 I197F probably benign Het
Oma1 T C 4: 103,319,530 probably null Het
Pcp2 T A 8: 3,625,534 probably benign Het
Pdk4 T A 6: 5,489,157 H250L possibly damaging Het
Phldb3 A G 7: 24,624,291 H449R probably benign Het
Pip4k2c T C 10: 127,199,327 T391A possibly damaging Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Prkcg T G 7: 3,330,265 Y624* probably null Het
Psmg2 A G 18: 67,648,856 E164G probably damaging Het
Rb1 A T 14: 73,216,691 L589H probably damaging Het
Rcvrn A T 11: 67,695,765 I117F probably damaging Het
Rere T A 4: 150,619,144 W1528R probably damaging Het
Robo2 A G 16: 73,898,915 S1447P possibly damaging Het
Scfd2 C A 5: 74,462,658 G405W probably damaging Het
Scin T A 12: 40,069,374 I552F possibly damaging Het
Serpina3k G A 12: 104,343,010 V238M probably damaging Het
Slc1a6 G A 10: 78,796,251 V304M probably damaging Het
Slc20a2 C T 8: 22,561,004 S351L probably damaging Het
Slc31a2 T C 4: 62,297,088 V124A probably damaging Het
Slc38a3 T C 9: 107,656,227 N244S probably benign Het
Slc4a1 A G 11: 102,352,453 V784A probably damaging Het
Slc6a5 T C 7: 49,948,256 F623L probably benign Het
Slf2 T G 19: 44,971,661 D1022E probably damaging Het
Slfn8 G A 11: 83,016,878 H280Y probably damaging Het
Smpdl3a A T 10: 57,801,031 D45V probably damaging Het
Ssh3 T C 19: 4,265,142 E342G probably damaging Het
Tacr1 A T 6: 82,554,941 I273F probably benign Het
Tfg T A 16: 56,694,396 probably null Het
Tmem179 A G 12: 112,501,834 L71P probably damaging Het
Tmem63a T A 1: 180,966,521 I541N probably benign Het
Traj20 G A 14: 54,199,467 probably benign Het
Trappc13 A T 13: 104,154,294 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tulp1 A G 17: 28,359,135 L310P probably damaging Het
Ube2cbp A G 9: 86,422,872 Y306H probably damaging Het
Urb1 A T 16: 90,783,328 V649E probably damaging Het
Vps13d A G 4: 144,983,393 L4211P probably damaging Het
Vwa5b1 T A 4: 138,594,262 I407F possibly damaging Het
Vwce G T 19: 10,646,879 C378F probably damaging Het
Zfp791 T A 8: 85,110,951 I95L probably benign Het
Other mutations in Ano3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ano3 APN 2 110771050 splice site probably benign
IGL01066:Ano3 APN 2 110661445 missense probably null 0.00
IGL01696:Ano3 APN 2 110667737 missense probably damaging 1.00
IGL01729:Ano3 APN 2 110781394 splice site probably null
IGL01785:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01786:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01992:Ano3 APN 2 110658219 missense probably damaging 1.00
IGL02098:Ano3 APN 2 110666441 nonsense probably null
IGL02333:Ano3 APN 2 110697199 splice site probably benign
IGL02346:Ano3 APN 2 110770926 splice site probably benign
IGL02352:Ano3 APN 2 110884943 nonsense probably null
IGL02359:Ano3 APN 2 110884943 nonsense probably null
IGL02544:Ano3 APN 2 110658249 missense possibly damaging 0.79
IGL02750:Ano3 APN 2 110665984 splice site probably benign
IGL02861:Ano3 APN 2 110738812 missense probably damaging 1.00
IGL02948:Ano3 APN 2 110697018 splice site probably benign
IGL03327:Ano3 APN 2 110697178 missense possibly damaging 0.62
3-1:Ano3 UTSW 2 110697124 missense probably damaging 1.00
IGL02988:Ano3 UTSW 2 110775010 missense probably damaging 1.00
IGL03147:Ano3 UTSW 2 110697418 missense probably damaging 1.00
R0349:Ano3 UTSW 2 110661487 missense probably damaging 1.00
R0426:Ano3 UTSW 2 110661174 missense probably damaging 1.00
R0523:Ano3 UTSW 2 110884855 missense probably benign 0.13
R0557:Ano3 UTSW 2 110862952 splice site probably null
R0611:Ano3 UTSW 2 110885001 missense possibly damaging 0.93
R0891:Ano3 UTSW 2 110697976 missense probably benign 0.03
R1459:Ano3 UTSW 2 110880829 missense probably benign 0.00
R1460:Ano3 UTSW 2 110682758 missense probably damaging 0.97
R1773:Ano3 UTSW 2 110761455 missense probably damaging 1.00
R1874:Ano3 UTSW 2 110884872 missense probably benign 0.00
R1919:Ano3 UTSW 2 110885007 missense probably benign
R2185:Ano3 UTSW 2 110775045 missense probably benign 0.01
R2280:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2281:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2348:Ano3 UTSW 2 110783743 missense possibly damaging 0.82
R2425:Ano3 UTSW 2 110862843 missense probably benign
R2697:Ano3 UTSW 2 110794960 missense possibly damaging 0.79
R3888:Ano3 UTSW 2 110885000 missense probably damaging 0.99
R3923:Ano3 UTSW 2 110770959 missense probably damaging 1.00
R4352:Ano3 UTSW 2 110745894 missense possibly damaging 0.74
R4447:Ano3 UTSW 2 110761578 splice site probably null
R4790:Ano3 UTSW 2 110884919 missense probably benign
R4832:Ano3 UTSW 2 110667722 missense probably damaging 1.00
R5113:Ano3 UTSW 2 110661480 missense possibly damaging 0.61
R5486:Ano3 UTSW 2 110745870 missense probably damaging 1.00
R5498:Ano3 UTSW 2 110697103 missense possibly damaging 0.68
R5589:Ano3 UTSW 2 110884995 missense probably damaging 0.99
R5627:Ano3 UTSW 2 110756953 missense possibly damaging 0.61
R5741:Ano3 UTSW 2 110658273 missense probably benign 0.11
R5767:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R5883:Ano3 UTSW 2 110880864 missense probably null 0.15
R5899:Ano3 UTSW 2 110862887 missense probably benign 0.39
R5916:Ano3 UTSW 2 110681836 missense probably benign 0.29
R6158:Ano3 UTSW 2 110665875 missense probably damaging 1.00
R6315:Ano3 UTSW 2 110697039 missense probably damaging 1.00
R6401:Ano3 UTSW 2 110775114 missense probably benign 0.01
R6481:Ano3 UTSW 2 110795027 missense probably benign 0.16
R6482:Ano3 UTSW 2 110697055 missense probably damaging 1.00
R6587:Ano3 UTSW 2 110797904 splice site probably null
R6811:Ano3 UTSW 2 110880867 missense probably benign 0.03
R7048:Ano3 UTSW 2 110682771 nonsense probably null
R7145:Ano3 UTSW 2 110862860 missense probably benign 0.31
R7207:Ano3 UTSW 2 110781423 missense probably damaging 0.96
R7215:Ano3 UTSW 2 110665932 missense probably damaging 1.00
R7366:Ano3 UTSW 2 110757067 missense probably damaging 1.00
R7371:Ano3 UTSW 2 110884849 critical splice donor site probably null
R7568:Ano3 UTSW 2 110950293 start gained probably benign
R7636:Ano3 UTSW 2 110682703 nonsense probably null
R7888:Ano3 UTSW 2 110666428 missense probably damaging 1.00
R7992:Ano3 UTSW 2 110775022 missense possibly damaging 0.77
R8024:Ano3 UTSW 2 110667783 missense probably damaging 0.99
R8074:Ano3 UTSW 2 110950232 start gained probably benign
R8111:Ano3 UTSW 2 110783713 missense possibly damaging 0.95
R8177:Ano3 UTSW 2 110666456 missense probably damaging 1.00
R8297:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R8485:Ano3 UTSW 2 110667855 critical splice acceptor site probably null
R8509:Ano3 UTSW 2 110665835 missense possibly damaging 0.50
R8870:Ano3 UTSW 2 110783729 missense probably benign 0.12
R9071:Ano3 UTSW 2 110795073 critical splice acceptor site probably null
R9072:Ano3 UTSW 2 110745898 missense probably benign 0.06
R9073:Ano3 UTSW 2 110745898 missense probably benign 0.06
R9315:Ano3 UTSW 2 110697942 missense probably damaging 0.97
R9376:Ano3 UTSW 2 110666437 missense probably damaging 1.00
R9588:Ano3 UTSW 2 110697997 missense not run
RF012:Ano3 UTSW 2 110697523 missense possibly damaging 0.83
RF013:Ano3 UTSW 2 110697036 missense probably benign 0.30
X0058:Ano3 UTSW 2 110697418 missense probably damaging 1.00
Z1088:Ano3 UTSW 2 110745847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCCATGCTGAACCCTTTC -3'
(R):5'- TCCCAGCAAGTACGTGATAAAC -3'

Sequencing Primer
(F):5'- AACCCTATTTTCATTTAAAGCCGC -3'
(R):5'- GGACATATACGAATACCAAAACCTC -3'
Posted On 2016-04-15