Incidental Mutation 'R4916:Adnp'
ID 380034
Institutional Source Beutler Lab
Gene Symbol Adnp
Ensembl Gene ENSMUSG00000051149
Gene Name activity-dependent neuroprotective protein
Synonyms
MMRRC Submission 042518-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4916 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 168022906-168049032 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 168029537 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 51 (T51S)
Ref Sequence ENSEMBL: ENSMUSP00000085316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057793] [ENSMUST00000088001] [ENSMUST00000138667]
AlphaFold Q9Z103
Predicted Effect possibly damaging
Transcript: ENSMUST00000057793
AA Change: T51S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000056809
Gene: ENSMUSG00000051149
AA Change: T51S

DomainStartEndE-ValueType
ZnF_C2H2 74 97 6.57e0 SMART
ZnF_C2H2 107 129 1.77e1 SMART
low complexity region 130 141 N/A INTRINSIC
ZnF_C2H2 165 188 1.29e1 SMART
ZnF_C2H2 221 244 1.4e1 SMART
low complexity region 423 437 N/A INTRINSIC
ZnF_C2H2 446 468 8.62e1 SMART
ZnF_C2H2 488 509 2.54e1 SMART
ZnF_C2H2 511 534 1.03e-2 SMART
low complexity region 582 596 N/A INTRINSIC
ZnF_C2H2 621 646 1.27e2 SMART
HOX 756 817 2.95e-6 SMART
low complexity region 957 970 N/A INTRINSIC
low complexity region 1012 1023 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000088001
AA Change: T51S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000085316
Gene: ENSMUSG00000051149
AA Change: T51S

DomainStartEndE-ValueType
ZnF_C2H2 74 97 6.57e0 SMART
ZnF_C2H2 107 129 1.77e1 SMART
low complexity region 130 141 N/A INTRINSIC
ZnF_C2H2 165 188 1.29e1 SMART
ZnF_C2H2 221 244 1.4e1 SMART
low complexity region 423 437 N/A INTRINSIC
ZnF_C2H2 446 468 8.62e1 SMART
ZnF_C2H2 488 509 2.54e1 SMART
ZnF_C2H2 511 534 1.03e-2 SMART
low complexity region 582 596 N/A INTRINSIC
ZnF_C2H2 621 646 1.27e2 SMART
HOX 756 817 2.95e-6 SMART
low complexity region 957 970 N/A INTRINSIC
low complexity region 1012 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138667
SMART Domains Protein: ENSMUSP00000139070
Gene: ENSMUSG00000093752

DomainStartEndE-ValueType
Pfam:Glyco_tranf_2_3 24 240 1.1e-13 PFAM
Pfam:Glyco_tranf_2_2 28 153 8.4e-10 PFAM
Pfam:Glycos_transf_2 28 199 3.8e-40 PFAM
Pfam:Glyco_transf_21 87 200 1.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139984
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a protein family characterized by nine zinc finger motifs followed by a homeobox domain. In vitro studies demonstrate that the encoded protein interacts with the brahma-related gene1-associated or hBRM factors (BAF) gene expression regulating complex, components of the protein translation machinery, and microtubule-associated proteins. This gene has been implicated in neuroprotection through various processes that include chromatin remodeling, splicing, cytoskeletal reorganization, and autophagy. Homozygous mutant knockout mice display embryonic lethality with defects in neural tube closure. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Developmental defects including the failure of the cranial neural tube to close lead to embryonic death between E8.5 and E9. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930595D18Rik G A 12: 111,141,369 (GRCm39) Q19* probably null Het
6030468B19Rik T A 11: 117,697,092 (GRCm39) C230* probably null Het
Adcy10 A G 1: 165,345,815 (GRCm39) E288G probably damaging Het
Agap3 C A 5: 24,683,011 (GRCm39) A464D probably damaging Het
Ago4 A C 4: 126,400,635 (GRCm39) C693G probably damaging Het
Ahi1 A G 10: 20,860,303 (GRCm39) R675G probably damaging Het
Amigo1 T A 3: 108,094,981 (GRCm39) L160Q probably damaging Het
Ankrd35 T C 3: 96,591,438 (GRCm39) S575P probably benign Het
Ano3 T A 2: 110,601,365 (GRCm39) T298S possibly damaging Het
Ap2b1 T G 11: 83,281,532 (GRCm39) F813V probably damaging Het
Aplnr T G 2: 84,967,261 (GRCm39) F95L probably damaging Het
Apobec2 T C 17: 48,730,153 (GRCm39) E171G probably benign Het
Ascc1 A G 10: 59,840,684 (GRCm39) N15S probably benign Het
AY358078 T A 14: 52,040,108 (GRCm39) Y73N unknown Het
B3gnt8 C A 7: 25,328,308 (GRCm39) P246Q probably damaging Het
C2cd2l T C 9: 44,227,857 (GRCm39) Q250R probably damaging Het
Camk2d T C 3: 126,577,624 (GRCm39) Y180H probably damaging Het
Ccdc170 A G 10: 4,468,971 (GRCm39) E167G probably damaging Het
Cdcp3 T A 7: 130,776,206 (GRCm39) probably null Het
Cdyl2 A G 8: 117,305,926 (GRCm39) M445T probably damaging Het
Clca3a1 T C 3: 144,721,605 (GRCm39) D322G probably benign Het
Cnot10 C T 9: 114,458,202 (GRCm39) M101I possibly damaging Het
Cntrl C T 2: 35,055,694 (GRCm39) T1196M probably benign Het
Cybb C G X: 9,316,989 (GRCm39) D246H probably benign Het
Dcaf6 T C 1: 165,247,774 (GRCm39) D153G probably damaging Het
Dennd2c G A 3: 103,039,140 (GRCm39) G96E probably benign Het
Dhrs9 T C 2: 69,231,752 (GRCm39) F304S probably damaging Het
Dmxl1 T C 18: 50,010,764 (GRCm39) S974P probably damaging Het
Dnah6 T C 6: 73,169,659 (GRCm39) probably benign Het
Dnah7c T C 1: 46,634,168 (GRCm39) L1049P probably damaging Het
Dnajc2 T C 5: 21,962,338 (GRCm39) K621E probably damaging Het
Ehbp1 T C 11: 22,096,592 (GRCm39) D299G probably benign Het
Erap1 A G 13: 74,794,647 (GRCm39) E102G probably benign Het
Fasn T G 11: 120,707,472 (GRCm39) N799T probably benign Het
Fbxl20 T C 11: 98,019,186 (GRCm39) D22G probably damaging Het
Fgfr1 T C 8: 26,053,542 (GRCm39) probably null Het
Frzb A T 2: 80,276,871 (GRCm39) I105N probably damaging Het
Gabrb1 T A 5: 72,026,764 (GRCm39) F55Y probably damaging Het
Gatd1 G T 7: 140,989,010 (GRCm39) C216* probably null Het
Gnl2 A C 4: 124,937,485 (GRCm39) N255T probably damaging Het
Golgb1 A T 16: 36,736,480 (GRCm39) Q1909L probably benign Het
Gpnmb T C 6: 49,028,904 (GRCm39) L474P probably damaging Het
H60b T C 10: 22,163,115 (GRCm39) V230A possibly damaging Het
Hmcn2 T A 2: 31,250,992 (GRCm39) V818D probably damaging Het
Irag2 C A 6: 145,111,027 (GRCm39) S277R probably damaging Het
Itprid1 C T 6: 55,955,175 (GRCm39) P928S possibly damaging Het
Jade2 G T 11: 51,707,909 (GRCm39) T768K probably benign Het
Kif28 T C 1: 179,530,085 (GRCm39) H692R probably benign Het
Kmt2b T C 7: 30,277,942 (GRCm39) N1634S probably damaging Het
Knop1 A G 7: 118,445,299 (GRCm39) W222R probably damaging Het
Map1b T C 13: 99,569,808 (GRCm39) D971G unknown Het
Mapk7 G T 11: 61,384,475 (GRCm39) T77K probably damaging Het
Mcm6 A G 1: 128,276,714 (GRCm39) L292P probably damaging Het
Megf8 T C 7: 25,039,089 (GRCm39) L900P probably benign Het
Meis1 G A 11: 18,831,776 (GRCm39) H421Y possibly damaging Het
Minar2 A T 18: 59,205,277 (GRCm39) I22F probably damaging Het
Mllt1 T C 17: 57,206,813 (GRCm39) T344A probably benign Het
Mta1 T A 12: 113,100,160 (GRCm39) S657T probably benign Het
Mtus1 C A 8: 41,453,838 (GRCm39) K998N probably damaging Het
Ncdn G A 4: 126,643,731 (GRCm39) L364F possibly damaging Het
Ndufb7 T C 8: 84,297,534 (GRCm39) L63P probably damaging Het
Nfix T C 8: 85,498,458 (GRCm39) I172V probably benign Het
Nos1 T C 5: 118,085,635 (GRCm39) probably null Het
Nrp1 C A 8: 129,229,285 (GRCm39) S921* probably null Het
Oma1 T C 4: 103,176,727 (GRCm39) probably null Het
Or3a1b A T 11: 74,012,705 (GRCm39) I197F probably benign Het
Or5b106 T A 19: 13,123,355 (GRCm39) I223L possibly damaging Het
Pcp2 T A 8: 3,675,534 (GRCm39) probably benign Het
Pdk4 T A 6: 5,489,157 (GRCm39) H250L possibly damaging Het
Phldb3 A G 7: 24,323,716 (GRCm39) H449R probably benign Het
Pip4k2c T C 10: 127,035,196 (GRCm39) T391A possibly damaging Het
Polrmt A G 10: 79,582,385 (GRCm39) M1T probably null Het
Ppfia2 G C 10: 106,597,978 (GRCm39) L180F probably damaging Het
Prkcg T G 7: 3,378,781 (GRCm39) Y624* probably null Het
Psmg2 A G 18: 67,781,926 (GRCm39) E164G probably damaging Het
Rb1 A T 14: 73,454,131 (GRCm39) L589H probably damaging Het
Rcvrn A T 11: 67,586,591 (GRCm39) I117F probably damaging Het
Rere T A 4: 150,703,601 (GRCm39) W1528R probably damaging Het
Robo2 A G 16: 73,695,803 (GRCm39) S1447P possibly damaging Het
Scfd2 C A 5: 74,623,319 (GRCm39) G405W probably damaging Het
Scin T A 12: 40,119,373 (GRCm39) I552F possibly damaging Het
Serpina3k G A 12: 104,309,269 (GRCm39) V238M probably damaging Het
Slc1a6 G A 10: 78,632,085 (GRCm39) V304M probably damaging Het
Slc20a2 C T 8: 23,051,020 (GRCm39) S351L probably damaging Het
Slc31a2 T C 4: 62,215,325 (GRCm39) V124A probably damaging Het
Slc38a3 T C 9: 107,533,426 (GRCm39) N244S probably benign Het
Slc4a1 A G 11: 102,243,279 (GRCm39) V784A probably damaging Het
Slc6a5 T C 7: 49,598,004 (GRCm39) F623L probably benign Het
Slf2 T G 19: 44,960,100 (GRCm39) D1022E probably damaging Het
Slfn8 G A 11: 82,907,704 (GRCm39) H280Y probably damaging Het
Smpdl3a A T 10: 57,677,127 (GRCm39) D45V probably damaging Het
Ssh3 T C 19: 4,315,170 (GRCm39) E342G probably damaging Het
Tacr1 A T 6: 82,531,922 (GRCm39) I273F probably benign Het
Tfg T A 16: 56,514,759 (GRCm39) probably null Het
Tmem179 A G 12: 112,468,268 (GRCm39) L71P probably damaging Het
Tmem63a T A 1: 180,794,086 (GRCm39) I541N probably benign Het
Traj20 G A 14: 54,436,924 (GRCm39) probably benign Het
Trappc13 A T 13: 104,290,802 (GRCm39) probably null Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Tulp1 A G 17: 28,578,109 (GRCm39) L310P probably damaging Het
Ube3d A G 9: 86,304,925 (GRCm39) Y306H probably damaging Het
Urb1 A T 16: 90,580,216 (GRCm39) V649E probably damaging Het
Vps13d A G 4: 144,709,963 (GRCm39) L4211P probably damaging Het
Vwa5b1 T A 4: 138,321,573 (GRCm39) I407F possibly damaging Het
Vwce G T 19: 10,624,243 (GRCm39) C378F probably damaging Het
Zfp791 T A 8: 85,837,580 (GRCm39) I95L probably benign Het
Other mutations in Adnp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Adnp APN 2 168,024,482 (GRCm39) missense probably benign
IGL00500:Adnp APN 2 168,025,243 (GRCm39) missense possibly damaging 0.85
IGL01604:Adnp APN 2 168,026,258 (GRCm39) missense probably damaging 0.99
IGL01967:Adnp APN 2 168,025,339 (GRCm39) missense possibly damaging 0.85
IGL02470:Adnp APN 2 168,025,114 (GRCm39) missense probably damaging 0.99
C9142:Adnp UTSW 2 168,026,327 (GRCm39) missense probably damaging 0.99
R0893:Adnp UTSW 2 168,025,647 (GRCm39) missense possibly damaging 0.85
R1167:Adnp UTSW 2 168,026,420 (GRCm39) missense probably benign 0.11
R1182:Adnp UTSW 2 168,026,716 (GRCm39) missense possibly damaging 0.77
R1480:Adnp UTSW 2 168,025,454 (GRCm39) missense probably damaging 0.99
R1505:Adnp UTSW 2 168,025,661 (GRCm39) missense possibly damaging 0.93
R1906:Adnp UTSW 2 168,024,287 (GRCm39) missense probably benign
R3711:Adnp UTSW 2 168,026,743 (GRCm39) missense probably damaging 0.98
R3943:Adnp UTSW 2 168,026,980 (GRCm39) missense possibly damaging 0.92
R4440:Adnp UTSW 2 168,026,721 (GRCm39) missense possibly damaging 0.92
R4686:Adnp UTSW 2 168,024,309 (GRCm39) missense possibly damaging 0.78
R5072:Adnp UTSW 2 168,024,921 (GRCm39) missense probably damaging 0.96
R5312:Adnp UTSW 2 168,026,108 (GRCm39) missense probably benign
R5393:Adnp UTSW 2 168,024,869 (GRCm39) missense possibly damaging 0.95
R5598:Adnp UTSW 2 168,025,645 (GRCm39) missense probably damaging 0.99
R6230:Adnp UTSW 2 168,024,452 (GRCm39) missense probably benign
R7165:Adnp UTSW 2 168,024,287 (GRCm39) missense probably benign 0.07
R7176:Adnp UTSW 2 168,024,578 (GRCm39) missense probably benign
R7238:Adnp UTSW 2 168,025,887 (GRCm39) missense probably damaging 1.00
R7254:Adnp UTSW 2 168,025,918 (GRCm39) missense probably damaging 0.99
R7581:Adnp UTSW 2 168,025,386 (GRCm39) missense probably damaging 0.96
R7676:Adnp UTSW 2 168,025,367 (GRCm39) nonsense probably null
R7863:Adnp UTSW 2 168,031,270 (GRCm39) missense possibly damaging 0.91
R8098:Adnp UTSW 2 168,024,452 (GRCm39) missense probably benign
R8196:Adnp UTSW 2 168,025,092 (GRCm39) missense probably benign
R8970:Adnp UTSW 2 168,031,290 (GRCm39) missense possibly damaging 0.91
R9153:Adnp UTSW 2 168,026,580 (GRCm39) missense possibly damaging 0.96
R9154:Adnp UTSW 2 168,026,580 (GRCm39) missense possibly damaging 0.96
R9228:Adnp UTSW 2 168,026,798 (GRCm39) missense probably damaging 0.98
R9256:Adnp UTSW 2 168,025,945 (GRCm39) missense probably damaging 1.00
R9268:Adnp UTSW 2 168,031,233 (GRCm39) missense possibly damaging 0.86
R9434:Adnp UTSW 2 168,026,377 (GRCm39) missense probably damaging 0.99
R9517:Adnp UTSW 2 168,024,866 (GRCm39) missense possibly damaging 0.93
R9621:Adnp UTSW 2 168,024,663 (GRCm39) missense probably benign 0.22
R9669:Adnp UTSW 2 168,026,918 (GRCm39) missense possibly damaging 0.91
R9737:Adnp UTSW 2 168,026,918 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ACCTGGTTTTCCTACCACTGAG -3'
(R):5'- TACTTTGGAAAGCTGGCCGTG -3'

Sequencing Primer
(F):5'- TCCTACCACTGAGGAAAATTGAG -3'
(R):5'- TGAGAGCCTCAGCACTAGTG -3'
Posted On 2016-04-15