Incidental Mutation 'R4916:Ago4'
ID 380043
Institutional Source Beutler Lab
Gene Symbol Ago4
Ensembl Gene ENSMUSG00000042500
Gene Name argonaute RISC catalytic subunit 4
Synonyms Eif2c4, 5730550L01Rik, argonaute 4
MMRRC Submission 042518-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.917) question?
Stock # R4916 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 126383334-126427265 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 126400635 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Glycine at position 693 (C693G)
Ref Sequence ENSEMBL: ENSMUSP00000081312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084289]
AlphaFold Q8CJF8
Predicted Effect probably damaging
Transcript: ENSMUST00000084289
AA Change: C693G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081312
Gene: ENSMUSG00000042500
AA Change: C693G

DomainStartEndE-ValueType
Pfam:ArgoN 18 156 3.9e-28 PFAM
DUF1785 165 217 4.22e-24 SMART
PAZ 225 360 1.26e-3 SMART
Pfam:ArgoL2 365 412 1.2e-16 PFAM
Pfam:ArgoMid 421 503 8.6e-35 PFAM
Piwi 509 820 2.9e-130 SMART
Blast:Piwi 827 856 2e-9 BLAST
Meta Mutation Damage Score 0.9258 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Argonaute family of proteins which contain PAZ and PIWI domains and play an integral role in RNA interference and short-interfering-RNA-mediated gene silencing. This gene is located on chromosome 1 in a cluster of related family members. [provided by RefSeq, Mar 2017]
PHENOTYPE: Male mice homozygous for a null mutation display oligozoospermia, decreased testis weight, premature entry into meiosis and disruption of sex body formation. However both males and females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930595D18Rik G A 12: 111,141,369 (GRCm39) Q19* probably null Het
6030468B19Rik T A 11: 117,697,092 (GRCm39) C230* probably null Het
Adcy10 A G 1: 165,345,815 (GRCm39) E288G probably damaging Het
Adnp T A 2: 168,029,537 (GRCm39) T51S possibly damaging Het
Agap3 C A 5: 24,683,011 (GRCm39) A464D probably damaging Het
Ahi1 A G 10: 20,860,303 (GRCm39) R675G probably damaging Het
Amigo1 T A 3: 108,094,981 (GRCm39) L160Q probably damaging Het
Ankrd35 T C 3: 96,591,438 (GRCm39) S575P probably benign Het
Ano3 T A 2: 110,601,365 (GRCm39) T298S possibly damaging Het
Ap2b1 T G 11: 83,281,532 (GRCm39) F813V probably damaging Het
Aplnr T G 2: 84,967,261 (GRCm39) F95L probably damaging Het
Apobec2 T C 17: 48,730,153 (GRCm39) E171G probably benign Het
Ascc1 A G 10: 59,840,684 (GRCm39) N15S probably benign Het
AY358078 T A 14: 52,040,108 (GRCm39) Y73N unknown Het
B3gnt8 C A 7: 25,328,308 (GRCm39) P246Q probably damaging Het
C2cd2l T C 9: 44,227,857 (GRCm39) Q250R probably damaging Het
Camk2d T C 3: 126,577,624 (GRCm39) Y180H probably damaging Het
Ccdc170 A G 10: 4,468,971 (GRCm39) E167G probably damaging Het
Cdcp3 T A 7: 130,776,206 (GRCm39) probably null Het
Cdyl2 A G 8: 117,305,926 (GRCm39) M445T probably damaging Het
Clca3a1 T C 3: 144,721,605 (GRCm39) D322G probably benign Het
Cnot10 C T 9: 114,458,202 (GRCm39) M101I possibly damaging Het
Cntrl C T 2: 35,055,694 (GRCm39) T1196M probably benign Het
Cybb C G X: 9,316,989 (GRCm39) D246H probably benign Het
Dcaf6 T C 1: 165,247,774 (GRCm39) D153G probably damaging Het
Dennd2c G A 3: 103,039,140 (GRCm39) G96E probably benign Het
Dhrs9 T C 2: 69,231,752 (GRCm39) F304S probably damaging Het
Dmxl1 T C 18: 50,010,764 (GRCm39) S974P probably damaging Het
Dnah6 T C 6: 73,169,659 (GRCm39) probably benign Het
Dnah7c T C 1: 46,634,168 (GRCm39) L1049P probably damaging Het
Dnajc2 T C 5: 21,962,338 (GRCm39) K621E probably damaging Het
Ehbp1 T C 11: 22,096,592 (GRCm39) D299G probably benign Het
Erap1 A G 13: 74,794,647 (GRCm39) E102G probably benign Het
Fasn T G 11: 120,707,472 (GRCm39) N799T probably benign Het
Fbxl20 T C 11: 98,019,186 (GRCm39) D22G probably damaging Het
Fgfr1 T C 8: 26,053,542 (GRCm39) probably null Het
Frzb A T 2: 80,276,871 (GRCm39) I105N probably damaging Het
Gabrb1 T A 5: 72,026,764 (GRCm39) F55Y probably damaging Het
Gatd1 G T 7: 140,989,010 (GRCm39) C216* probably null Het
Gnl2 A C 4: 124,937,485 (GRCm39) N255T probably damaging Het
Golgb1 A T 16: 36,736,480 (GRCm39) Q1909L probably benign Het
Gpnmb T C 6: 49,028,904 (GRCm39) L474P probably damaging Het
H60b T C 10: 22,163,115 (GRCm39) V230A possibly damaging Het
Hmcn2 T A 2: 31,250,992 (GRCm39) V818D probably damaging Het
Irag2 C A 6: 145,111,027 (GRCm39) S277R probably damaging Het
Itprid1 C T 6: 55,955,175 (GRCm39) P928S possibly damaging Het
Jade2 G T 11: 51,707,909 (GRCm39) T768K probably benign Het
Kif28 T C 1: 179,530,085 (GRCm39) H692R probably benign Het
Kmt2b T C 7: 30,277,942 (GRCm39) N1634S probably damaging Het
Knop1 A G 7: 118,445,299 (GRCm39) W222R probably damaging Het
Map1b T C 13: 99,569,808 (GRCm39) D971G unknown Het
Mapk7 G T 11: 61,384,475 (GRCm39) T77K probably damaging Het
Mcm6 A G 1: 128,276,714 (GRCm39) L292P probably damaging Het
Megf8 T C 7: 25,039,089 (GRCm39) L900P probably benign Het
Meis1 G A 11: 18,831,776 (GRCm39) H421Y possibly damaging Het
Minar2 A T 18: 59,205,277 (GRCm39) I22F probably damaging Het
Mllt1 T C 17: 57,206,813 (GRCm39) T344A probably benign Het
Mta1 T A 12: 113,100,160 (GRCm39) S657T probably benign Het
Mtus1 C A 8: 41,453,838 (GRCm39) K998N probably damaging Het
Ncdn G A 4: 126,643,731 (GRCm39) L364F possibly damaging Het
Ndufb7 T C 8: 84,297,534 (GRCm39) L63P probably damaging Het
Nfix T C 8: 85,498,458 (GRCm39) I172V probably benign Het
Nos1 T C 5: 118,085,635 (GRCm39) probably null Het
Nrp1 C A 8: 129,229,285 (GRCm39) S921* probably null Het
Oma1 T C 4: 103,176,727 (GRCm39) probably null Het
Or3a1b A T 11: 74,012,705 (GRCm39) I197F probably benign Het
Or5b106 T A 19: 13,123,355 (GRCm39) I223L possibly damaging Het
Pcp2 T A 8: 3,675,534 (GRCm39) probably benign Het
Pdk4 T A 6: 5,489,157 (GRCm39) H250L possibly damaging Het
Phldb3 A G 7: 24,323,716 (GRCm39) H449R probably benign Het
Pip4k2c T C 10: 127,035,196 (GRCm39) T391A possibly damaging Het
Polrmt A G 10: 79,582,385 (GRCm39) M1T probably null Het
Ppfia2 G C 10: 106,597,978 (GRCm39) L180F probably damaging Het
Prkcg T G 7: 3,378,781 (GRCm39) Y624* probably null Het
Psmg2 A G 18: 67,781,926 (GRCm39) E164G probably damaging Het
Rb1 A T 14: 73,454,131 (GRCm39) L589H probably damaging Het
Rcvrn A T 11: 67,586,591 (GRCm39) I117F probably damaging Het
Rere T A 4: 150,703,601 (GRCm39) W1528R probably damaging Het
Robo2 A G 16: 73,695,803 (GRCm39) S1447P possibly damaging Het
Scfd2 C A 5: 74,623,319 (GRCm39) G405W probably damaging Het
Scin T A 12: 40,119,373 (GRCm39) I552F possibly damaging Het
Serpina3k G A 12: 104,309,269 (GRCm39) V238M probably damaging Het
Slc1a6 G A 10: 78,632,085 (GRCm39) V304M probably damaging Het
Slc20a2 C T 8: 23,051,020 (GRCm39) S351L probably damaging Het
Slc31a2 T C 4: 62,215,325 (GRCm39) V124A probably damaging Het
Slc38a3 T C 9: 107,533,426 (GRCm39) N244S probably benign Het
Slc4a1 A G 11: 102,243,279 (GRCm39) V784A probably damaging Het
Slc6a5 T C 7: 49,598,004 (GRCm39) F623L probably benign Het
Slf2 T G 19: 44,960,100 (GRCm39) D1022E probably damaging Het
Slfn8 G A 11: 82,907,704 (GRCm39) H280Y probably damaging Het
Smpdl3a A T 10: 57,677,127 (GRCm39) D45V probably damaging Het
Ssh3 T C 19: 4,315,170 (GRCm39) E342G probably damaging Het
Tacr1 A T 6: 82,531,922 (GRCm39) I273F probably benign Het
Tfg T A 16: 56,514,759 (GRCm39) probably null Het
Tmem179 A G 12: 112,468,268 (GRCm39) L71P probably damaging Het
Tmem63a T A 1: 180,794,086 (GRCm39) I541N probably benign Het
Traj20 G A 14: 54,436,924 (GRCm39) probably benign Het
Trappc13 A T 13: 104,290,802 (GRCm39) probably null Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Tulp1 A G 17: 28,578,109 (GRCm39) L310P probably damaging Het
Ube3d A G 9: 86,304,925 (GRCm39) Y306H probably damaging Het
Urb1 A T 16: 90,580,216 (GRCm39) V649E probably damaging Het
Vps13d A G 4: 144,709,963 (GRCm39) L4211P probably damaging Het
Vwa5b1 T A 4: 138,321,573 (GRCm39) I407F possibly damaging Het
Vwce G T 19: 10,624,243 (GRCm39) C378F probably damaging Het
Zfp791 T A 8: 85,837,580 (GRCm39) I95L probably benign Het
Other mutations in Ago4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Ago4 APN 4 126,410,926 (GRCm39) missense probably benign 0.01
IGL00965:Ago4 APN 4 126,387,107 (GRCm39) missense probably benign 0.01
IGL01306:Ago4 APN 4 126,409,677 (GRCm39) splice site probably null
IGL01943:Ago4 APN 4 126,410,988 (GRCm39) missense probably damaging 1.00
IGL02079:Ago4 APN 4 126,410,877 (GRCm39) missense probably damaging 0.99
IGL02117:Ago4 APN 4 126,410,645 (GRCm39) missense probably benign 0.00
IGL02229:Ago4 APN 4 126,405,325 (GRCm39) missense probably benign 0.34
IGL02503:Ago4 APN 4 126,390,598 (GRCm39) nonsense probably null
IGL02504:Ago4 APN 4 126,411,232 (GRCm39) missense probably benign 0.00
IGL02975:Ago4 APN 4 126,406,312 (GRCm39) critical splice donor site probably null
BB010:Ago4 UTSW 4 126,400,811 (GRCm39) missense probably benign 0.22
BB020:Ago4 UTSW 4 126,400,811 (GRCm39) missense probably benign 0.22
IGL02837:Ago4 UTSW 4 126,391,093 (GRCm39) missense possibly damaging 0.73
R0129:Ago4 UTSW 4 126,410,976 (GRCm39) missense possibly damaging 0.85
R0142:Ago4 UTSW 4 126,410,725 (GRCm39) missense probably benign 0.24
R0480:Ago4 UTSW 4 126,419,870 (GRCm39) missense probably benign 0.00
R0533:Ago4 UTSW 4 126,410,653 (GRCm39) missense probably benign 0.00
R1014:Ago4 UTSW 4 126,400,578 (GRCm39) missense probably damaging 1.00
R1350:Ago4 UTSW 4 126,400,925 (GRCm39) missense probably benign 0.04
R1547:Ago4 UTSW 4 126,405,206 (GRCm39) missense probably benign 0.01
R1894:Ago4 UTSW 4 126,406,393 (GRCm39) missense probably benign 0.11
R1900:Ago4 UTSW 4 126,410,729 (GRCm39) missense probably benign 0.00
R2510:Ago4 UTSW 4 126,410,864 (GRCm39) missense probably damaging 1.00
R2511:Ago4 UTSW 4 126,410,864 (GRCm39) missense probably damaging 1.00
R4063:Ago4 UTSW 4 126,409,655 (GRCm39) intron probably benign
R4064:Ago4 UTSW 4 126,409,655 (GRCm39) intron probably benign
R4120:Ago4 UTSW 4 126,390,600 (GRCm39) missense probably damaging 1.00
R4917:Ago4 UTSW 4 126,400,635 (GRCm39) missense probably damaging 1.00
R4918:Ago4 UTSW 4 126,400,635 (GRCm39) missense probably damaging 1.00
R4941:Ago4 UTSW 4 126,419,847 (GRCm39) missense probably benign 0.00
R5169:Ago4 UTSW 4 126,405,520 (GRCm39) missense probably benign 0.06
R5262:Ago4 UTSW 4 126,390,557 (GRCm39) missense possibly damaging 0.66
R5385:Ago4 UTSW 4 126,411,349 (GRCm39) missense probably benign
R5757:Ago4 UTSW 4 126,419,877 (GRCm39) missense probably damaging 1.00
R6244:Ago4 UTSW 4 126,405,280 (GRCm39) missense possibly damaging 0.67
R6256:Ago4 UTSW 4 126,414,019 (GRCm39) missense probably damaging 1.00
R6389:Ago4 UTSW 4 126,401,037 (GRCm39) missense probably damaging 1.00
R6545:Ago4 UTSW 4 126,405,811 (GRCm39) missense probably benign 0.10
R7378:Ago4 UTSW 4 126,405,257 (GRCm39) missense probably benign
R7804:Ago4 UTSW 4 126,406,423 (GRCm39) missense probably benign 0.02
R7890:Ago4 UTSW 4 126,419,869 (GRCm39) missense probably benign 0.00
R7933:Ago4 UTSW 4 126,400,811 (GRCm39) missense probably benign 0.22
R8824:Ago4 UTSW 4 126,400,977 (GRCm39) missense probably benign 0.04
R8852:Ago4 UTSW 4 126,387,043 (GRCm39) missense probably benign 0.03
R8860:Ago4 UTSW 4 126,387,043 (GRCm39) missense probably benign 0.03
R9023:Ago4 UTSW 4 126,400,596 (GRCm39) missense probably damaging 1.00
R9127:Ago4 UTSW 4 126,400,904 (GRCm39) missense probably damaging 1.00
R9138:Ago4 UTSW 4 126,414,073 (GRCm39) nonsense probably null
R9447:Ago4 UTSW 4 126,402,151 (GRCm39) missense probably benign 0.13
X0062:Ago4 UTSW 4 126,409,734 (GRCm39) missense probably benign 0.00
X0064:Ago4 UTSW 4 126,411,275 (GRCm39) missense possibly damaging 0.87
Z1176:Ago4 UTSW 4 126,413,983 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACACAGGTGTTTTAGGGATACTG -3'
(R):5'- ACGCATCATCTACTACCGCG -3'

Sequencing Primer
(F):5'- GGGATACTGTAAACATCTCCTCAAAG -3'
(R):5'- ATCATCTACTACCGCGGAGGG -3'
Posted On 2016-04-15