Incidental Mutation 'R0244:Slf1'
ID38005
Institutional Source Beutler Lab
Gene Symbol Slf1
Ensembl Gene ENSMUSG00000021597
Gene NameSMC5-SMC6 complex localization factor 1
Synonyms2700017A04Rik, Brctx, Brctd1, C730024G01Rik, Ankrd32
MMRRC Submission 038482-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0244 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location77043088-77135473 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 77126632 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 28 (L28*)
Ref Sequence ENSEMBL: ENSMUSP00000123982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151524] [ENSMUST00000159300] [ENSMUST00000159462] [ENSMUST00000162921] [ENSMUST00000162944]
Predicted Effect probably null
Transcript: ENSMUST00000151524
AA Change: L28*
SMART Domains Protein: ENSMUSP00000118312
Gene: ENSMUSG00000021597
AA Change: L28*

DomainStartEndE-ValueType
BRCT 2 80 1.37e-2 SMART
BRCT 121 199 2.12e1 SMART
low complexity region 260 273 N/A INTRINSIC
low complexity region 527 541 N/A INTRINSIC
low complexity region 765 785 N/A INTRINSIC
ANK 802 832 1.52e0 SMART
ANK 836 865 4.32e-5 SMART
ANK 870 900 2.07e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159300
AA Change: L28*
SMART Domains Protein: ENSMUSP00000124865
Gene: ENSMUSG00000021597
AA Change: L28*

DomainStartEndE-ValueType
BRCT 2 80 1.37e-2 SMART
BRCT 121 199 2.12e1 SMART
low complexity region 260 273 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159462
AA Change: L34*
SMART Domains Protein: ENSMUSP00000124543
Gene: ENSMUSG00000021597
AA Change: L34*

DomainStartEndE-ValueType
BRCT 8 86 1.37e-2 SMART
BRCT 127 205 2.12e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162320
Predicted Effect probably null
Transcript: ENSMUST00000162921
AA Change: L28*
SMART Domains Protein: ENSMUSP00000124946
Gene: ENSMUSG00000021597
AA Change: L28*

DomainStartEndE-ValueType
BRCT 2 80 1.37e-2 SMART
Blast:BRCT 121 173 1e-8 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000162944
AA Change: L28*
SMART Domains Protein: ENSMUSP00000123982
Gene: ENSMUSG00000021597
AA Change: L28*

DomainStartEndE-ValueType
BRCT 2 80 1.37e-2 SMART
Blast:BRCT 121 173 1e-8 BLAST
Meta Mutation Damage Score 0.9712 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (88/89)
MGI Phenotype PHENOTYPE: Homozygous null mice are developmentally normal and fertile with no pathological abnormalities or defects in T-cell development and genomic stability. Mutant MEFs grow at a normal rate and are not more sensitive to DNA-damaging agents while thymocytes donot show any major cell cycle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,286,491 probably null Het
Adamdec1 A T 14: 68,568,723 C434* probably null Het
Adprhl1 A G 8: 13,242,391 probably benign Het
Ago1 T A 4: 126,463,706 I59F possibly damaging Het
Arel1 T C 12: 84,920,693 T786A probably damaging Het
Arhgap26 A G 18: 39,363,131 K117R probably benign Het
Atp6v0b C T 4: 117,884,622 G204D probably damaging Het
Bace2 T A 16: 97,436,773 probably null Het
Camk4 G A 18: 33,179,625 probably null Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cep152 T C 2: 125,564,214 E1466G probably benign Het
Ces3b T C 8: 105,092,635 F441S probably damaging Het
Cfap52 T C 11: 67,926,382 T562A possibly damaging Het
Clca3a2 C A 3: 144,813,898 M238I possibly damaging Het
Cntnap5c A T 17: 58,102,168 D467V probably damaging Het
Col7a1 T A 9: 108,972,184 probably null Het
Cstf1 A G 2: 172,377,710 N247S possibly damaging Het
Dffb G T 4: 153,974,615 N68K probably benign Het
Duox2 C T 2: 122,291,860 G595S probably benign Het
Eftud2 T A 11: 102,864,725 I228F probably damaging Het
Elmo3 T C 8: 105,309,171 V578A probably benign Het
Elp2 A G 18: 24,631,471 D625G possibly damaging Het
Ep300 C T 15: 81,640,128 P1386S unknown Het
Fam120b A G 17: 15,417,637 D610G probably damaging Het
Fastk A T 5: 24,442,178 probably benign Het
Fbxl6 A G 15: 76,537,191 S252P probably damaging Het
Fbxo43 T C 15: 36,161,793 K423E probably damaging Het
Filip1 T A 9: 79,819,462 E625V possibly damaging Het
Fkbp9 T A 6: 56,856,378 Y283* probably null Het
Gigyf2 T A 1: 87,379,015 D142E possibly damaging Het
Gm10142 T C 10: 77,716,014 probably null Het
Golga5 T C 12: 102,476,188 V262A probably benign Het
Hectd4 T C 5: 121,329,605 V2539A probably benign Het
Ica1 G T 6: 8,653,632 S335* probably null Het
Itga1 A T 13: 115,006,897 probably benign Het
Itgb1 T C 8: 128,717,685 probably benign Het
Itpr1 G A 6: 108,473,589 V1960I probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kprp C T 3: 92,825,411 V111I probably benign Het
Lamc3 T C 2: 31,940,721 I1490T probably damaging Het
Lcp1 A T 14: 75,227,001 D554V possibly damaging Het
Lgi3 A G 14: 70,534,698 T228A probably benign Het
Lipa A T 19: 34,501,541 F260I probably damaging Het
Lrriq1 C T 10: 103,215,773 E373K probably damaging Het
Map6 G A 7: 99,336,836 G649D probably benign Het
Mccc1 A G 3: 35,990,047 probably null Het
Mical3 A T 6: 120,957,722 S1799T probably benign Het
Mmp23 T A 4: 155,652,132 T151S probably damaging Het
Myo1d T A 11: 80,674,708 N401I probably damaging Het
Myo9b T A 8: 71,321,813 S323T probably damaging Het
Nbn G T 4: 15,979,353 W446L probably benign Het
Nedd1 A T 10: 92,716,265 probably benign Het
Ngef C A 1: 87,487,962 probably benign Het
Nup153 A T 13: 46,693,936 N672K probably benign Het
Olfr1308 T C 2: 111,961,016 N19S probably benign Het
Olfr149 T A 9: 39,702,173 I199F probably damaging Het
Olfr1509 T C 14: 52,450,512 V33A probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Palm2 T G 4: 57,710,177 V374G possibly damaging Het
Pdlim3 C A 8: 45,908,460 probably benign Het
Pmfbp1 G A 8: 109,541,673 E951K probably damaging Het
Pop1 T A 15: 34,515,891 C548* probably null Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Ptpdc1 A T 13: 48,585,980 N658K probably benign Het
Ptprk A C 10: 28,206,225 E63D possibly damaging Het
Rtf1 C T 2: 119,732,877 R712W probably damaging Het
Samd7 A C 3: 30,751,073 T2P probably benign Het
Sft2d1 A G 17: 8,319,422 T52A probably benign Het
Slc25a26 A G 6: 94,510,833 H91R probably damaging Het
Slc5a4a A G 10: 76,189,152 E621G possibly damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Sorcs2 G A 5: 36,397,553 probably benign Het
Tacc2 T C 7: 130,751,825 probably benign Het
Tas2r140 A G 6: 133,055,327 V156A possibly damaging Het
Terf2ip C A 8: 112,018,164 T371K possibly damaging Het
Tifa C T 3: 127,796,888 L103F probably damaging Het
Tmco3 A G 8: 13,292,037 N104D probably damaging Het
Tmem259 T A 10: 79,978,963 D240V probably damaging Het
Trim60 C T 8: 65,001,048 R183H probably benign Het
Trps1 T C 15: 50,664,743 N725D probably damaging Het
Ttn C T 2: 76,814,806 V12902M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Unc79 A G 12: 103,112,891 K1772E probably damaging Het
Vwde C T 6: 13,193,126 V405I probably benign Het
Wdr18 T A 10: 79,966,408 D290E probably damaging Het
Wdr92 T C 11: 17,229,851 L284P probably damaging Het
Wwc2 G A 8: 47,900,721 A126V probably benign Het
Zfp882 A T 8: 71,913,523 I105F possibly damaging Het
Zfp942 A T 17: 21,928,572 C359S probably benign Het
Other mutations in Slf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Slf1 APN 13 77043947 missense possibly damaging 0.95
IGL01105:Slf1 APN 13 77100912 unclassified probably benign
IGL01108:Slf1 APN 13 77125475 splice site probably benign
IGL01149:Slf1 APN 13 77112648 missense probably damaging 0.99
IGL01642:Slf1 APN 13 77049915 missense probably benign 0.00
IGL01757:Slf1 APN 13 77084440 missense probably benign
IGL01887:Slf1 APN 13 77100982 missense probably benign 0.02
IGL02323:Slf1 APN 13 77051294 missense possibly damaging 0.87
IGL02861:Slf1 APN 13 77126359 splice site probably benign
IGL02971:Slf1 APN 13 77047104 splice site probably benign
IGL03088:Slf1 APN 13 77084435 missense probably damaging 1.00
IGL03215:Slf1 APN 13 77049977 missense probably benign 0.00
IGL02980:Slf1 UTSW 13 77044004 missense possibly damaging 0.92
PIT1430001:Slf1 UTSW 13 77050050 splice site probably benign
R0036:Slf1 UTSW 13 77100951 missense probably benign 0.02
R0036:Slf1 UTSW 13 77100951 missense probably benign 0.02
R0125:Slf1 UTSW 13 77043745 missense probably benign 0.02
R0230:Slf1 UTSW 13 77112748 intron probably benign
R0395:Slf1 UTSW 13 77105969 splice site probably benign
R0614:Slf1 UTSW 13 77049114 missense probably benign 0.10
R0661:Slf1 UTSW 13 77083596 missense probably benign 0.31
R0837:Slf1 UTSW 13 77100948 splice site probably null
R0945:Slf1 UTSW 13 77103471 unclassified probably benign
R1282:Slf1 UTSW 13 77043840 missense probably damaging 0.97
R1365:Slf1 UTSW 13 77126371 missense probably damaging 1.00
R1449:Slf1 UTSW 13 77083449 missense probably damaging 1.00
R1646:Slf1 UTSW 13 77066648 nonsense probably null
R2071:Slf1 UTSW 13 77104624 missense probably benign 0.02
R2141:Slf1 UTSW 13 77049219 critical splice acceptor site probably null
R2217:Slf1 UTSW 13 77046706 critical splice acceptor site probably null
R2397:Slf1 UTSW 13 77103583 nonsense probably null
R2520:Slf1 UTSW 13 77051265 missense probably damaging 1.00
R3108:Slf1 UTSW 13 77126721 splice site probably benign
R4178:Slf1 UTSW 13 77043569 missense probably damaging 1.00
R4663:Slf1 UTSW 13 77126604 missense probably damaging 1.00
R4730:Slf1 UTSW 13 77046632 missense probably damaging 1.00
R4910:Slf1 UTSW 13 77043880 missense probably benign 0.14
R4912:Slf1 UTSW 13 77051294 missense probably damaging 1.00
R5122:Slf1 UTSW 13 77049987 missense probably benign 0.01
R5269:Slf1 UTSW 13 77104581 missense probably benign 0.33
R5336:Slf1 UTSW 13 77106010 makesense probably null
R5346:Slf1 UTSW 13 77092371 missense probably benign 0.00
R5445:Slf1 UTSW 13 77091204 missense probably benign 0.10
R5568:Slf1 UTSW 13 77046704 missense probably damaging 1.00
R5622:Slf1 UTSW 13 77049971 missense probably benign 0.14
R5685:Slf1 UTSW 13 77083479 missense possibly damaging 0.88
R5792:Slf1 UTSW 13 77066737 missense probably benign 0.03
R5856:Slf1 UTSW 13 77106087 missense possibly damaging 0.63
R6109:Slf1 UTSW 13 77126680 missense probably damaging 0.99
R6245:Slf1 UTSW 13 77084383 missense probably damaging 1.00
R6338:Slf1 UTSW 13 77084462 critical splice acceptor site probably null
R6438:Slf1 UTSW 13 77066606 missense probably damaging 1.00
R6487:Slf1 UTSW 13 77066617 missense probably damaging 1.00
R6597:Slf1 UTSW 13 77049129 missense probably benign 0.01
R6600:Slf1 UTSW 13 77083536 missense probably benign 0.00
R6661:Slf1 UTSW 13 77043845 missense probably damaging 1.00
R7268:Slf1 UTSW 13 77066707 missense probably damaging 1.00
R7308:Slf1 UTSW 13 77051168 missense probably benign 0.19
R7355:Slf1 UTSW 13 77091303 missense probably damaging 1.00
R7546:Slf1 UTSW 13 77049192 missense probably benign
R7807:Slf1 UTSW 13 77046704 missense probably damaging 1.00
R8175:Slf1 UTSW 13 77112671 missense probably damaging 1.00
R8385:Slf1 UTSW 13 77105990 missense probably benign
R8698:Slf1 UTSW 13 77049165 missense possibly damaging 0.78
R8770:Slf1 UTSW 13 77046647 missense probably damaging 1.00
R8786:Slf1 UTSW 13 77126687 missense possibly damaging 0.93
R8796:Slf1 UTSW 13 77066665 missense probably benign 0.00
X0018:Slf1 UTSW 13 77051238 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTGAAGGGAAGAACCCACATCAAG -3'
(R):5'- ACTGGAGGGTTTCAATGGTGAAACAAC -3'

Sequencing Primer
(F):5'- CCACATCAAGCAATATTACTACAGAG -3'
(R):5'- ATGGTTTTAGTTTCATTTTAGTGCTC -3'
Posted On2013-05-23