Mutagenetix > Incidental Mutation

Incidental Mutation 'R0244:Itga1'

38006

Institutional Source

Beutler Lab

Gene Symbol

Itga1

Ensembl Gene

ENSMUSG00000042284

Gene Name

integrin alpha 1

Synonyms

CD49A, Vla1, E130012M19Rik

MMRRC Submission

038482-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.329) question?

Stock #

R0244 (G1)

Quality Score

134

Status

Validated

Chromosome

Chromosomal Location

114953096-115101964 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 115006897 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000077132 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061673]

AlphaFold

Q3V3R4

Predicted Effect

probably benign
Transcript: ENSMUST00000061673

SMART Domains

Protein: ENSMUSP00000077132
Gene: ENSMUSG00000042284

Domain	Start	End	E-Value	Type
Int_alpha	43	96	1.63e0	SMART
VWA	170	360	4.24e-44	SMART
Int_alpha	432	481	4.21e-3	SMART
Int_alpha	485	542	3.19e-12	SMART
Int_alpha	566	621	1.79e-15	SMART
Int_alpha	628	682	3.04e1	SMART
low complexity region	1108	1122	N/A	INTRINSIC
PDB:2L8S\|A	1135	1179	5e-10	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224119

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224268

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224865

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.5%

Validation Efficiency

99% (88/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 1 subunit of integrin receptors. This protein heterodimerizes with the beta 1 subunit to form a cell-surface receptor for collagen and laminin. The heterodimeric receptor is involved in cell-cell adhesion and may play a role in inflammation and fibrosis. The alpha 1 subunit contains an inserted (I) von Willebrand factor type I domain which is thought to be involved in collagen binding. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially normal although their kidneys are smaller and more succeptible to injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,286,491		probably null	Het
Adamdec1	A	T	14: 68,568,723	C434*	probably null	Het
Adprhl1	A	G	8: 13,242,391		probably benign	Het
Ago1	T	A	4: 126,463,706	I59F	possibly damaging	Het
Arel1	T	C	12: 84,920,693	T786A	probably damaging	Het
Arhgap26	A	G	18: 39,363,131	K117R	probably benign	Het
Atp6v0b	C	T	4: 117,884,622	G204D	probably damaging	Het
Bace2	T	A	16: 97,436,773		probably null	Het
Camk4	G	A	18: 33,179,625		probably null	Het
Cdh26	C	T	2: 178,481,632	R675C	possibly damaging	Het
Cep152	T	C	2: 125,564,214	E1466G	probably benign	Het
Ces3b	T	C	8: 105,092,635	F441S	probably damaging	Het
Cfap52	T	C	11: 67,926,382	T562A	possibly damaging	Het
Clca3a2	C	A	3: 144,813,898	M238I	possibly damaging	Het
Cntnap5c	A	T	17: 58,102,168	D467V	probably damaging	Het
Col7a1	T	A	9: 108,972,184		probably null	Het
Cstf1	A	G	2: 172,377,710	N247S	possibly damaging	Het
Dffb	G	T	4: 153,974,615	N68K	probably benign	Het
Duox2	C	T	2: 122,291,860	G595S	probably benign	Het
Eftud2	T	A	11: 102,864,725	I228F	probably damaging	Het
Elmo3	T	C	8: 105,309,171	V578A	probably benign	Het
Elp2	A	G	18: 24,631,471	D625G	possibly damaging	Het
Ep300	C	T	15: 81,640,128	P1386S	unknown	Het
Fam120b	A	G	17: 15,417,637	D610G	probably damaging	Het
Fastk	A	T	5: 24,442,178		probably benign	Het
Fbxl6	A	G	15: 76,537,191	S252P	probably damaging	Het
Fbxo43	T	C	15: 36,161,793	K423E	probably damaging	Het
Filip1	T	A	9: 79,819,462	E625V	possibly damaging	Het
Fkbp9	T	A	6: 56,856,378	Y283*	probably null	Het
Gigyf2	T	A	1: 87,379,015	D142E	possibly damaging	Het
Gm10142	T	C	10: 77,716,014		probably null	Het
Golga5	T	C	12: 102,476,188	V262A	probably benign	Het
Hectd4	T	C	5: 121,329,605	V2539A	probably benign	Het
Ica1	G	T	6: 8,653,632	S335*	probably null	Het
Itgb1	T	C	8: 128,717,685		probably benign	Het
Itpr1	G	A	6: 108,473,589	V1960I	probably benign	Het
Kcnh4	C	T	11: 100,746,932	G633E	probably benign	Het
Kprp	C	T	3: 92,825,411	V111I	probably benign	Het
Lamc3	T	C	2: 31,940,721	I1490T	probably damaging	Het
Lcp1	A	T	14: 75,227,001	D554V	possibly damaging	Het
Lgi3	A	G	14: 70,534,698	T228A	probably benign	Het
Lipa	A	T	19: 34,501,541	F260I	probably damaging	Het
Lrriq1	C	T	10: 103,215,773	E373K	probably damaging	Het
Map6	G	A	7: 99,336,836	G649D	probably benign	Het
Mccc1	A	G	3: 35,990,047		probably null	Het
Mical3	A	T	6: 120,957,722	S1799T	probably benign	Het
Mmp23	T	A	4: 155,652,132	T151S	probably damaging	Het
Myo1d	T	A	11: 80,674,708	N401I	probably damaging	Het
Myo9b	T	A	8: 71,321,813	S323T	probably damaging	Het
Nbn	G	T	4: 15,979,353	W446L	probably benign	Het
Nedd1	A	T	10: 92,716,265		probably benign	Het
Ngef	C	A	1: 87,487,962		probably benign	Het
Nup153	A	T	13: 46,693,936	N672K	probably benign	Het
Olfr1308	T	C	2: 111,961,016	N19S	probably benign	Het
Olfr149	T	A	9: 39,702,173	I199F	probably damaging	Het
Olfr1509	T	C	14: 52,450,512	V33A	probably benign	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Palm2	T	G	4: 57,710,177	V374G	possibly damaging	Het
Pdlim3	C	A	8: 45,908,460		probably benign	Het
Pmfbp1	G	A	8: 109,541,673	E951K	probably damaging	Het
Pop1	T	A	15: 34,515,891	C548*	probably null	Het
Ppp1r16a	C	T	15: 76,690,799		probably benign	Het
Ptpdc1	A	T	13: 48,585,980	N658K	probably benign	Het
Ptprk	A	C	10: 28,206,225	E63D	possibly damaging	Het
Rtf1	C	T	2: 119,732,877	R712W	probably damaging	Het
Samd7	A	C	3: 30,751,073	T2P	probably benign	Het
Sft2d1	A	G	17: 8,319,422	T52A	probably benign	Het
Slc25a26	A	G	6: 94,510,833	H91R	probably damaging	Het
Slc5a4a	A	G	10: 76,189,152	E621G	possibly damaging	Het
Slf1	A	T	13: 77,126,632	L28*	probably null	Het
Snapc1	C	T	12: 73,975,032	R81C	probably damaging	Het
Sorcs2	G	A	5: 36,397,553		probably benign	Het
Tacc2	T	C	7: 130,751,825		probably benign	Het
Tas2r140	A	G	6: 133,055,327	V156A	possibly damaging	Het
Terf2ip	C	A	8: 112,018,164	T371K	possibly damaging	Het
Tifa	C	T	3: 127,796,888	L103F	probably damaging	Het
Tmco3	A	G	8: 13,292,037	N104D	probably damaging	Het
Tmem259	T	A	10: 79,978,963	D240V	probably damaging	Het
Trim60	C	T	8: 65,001,048	R183H	probably benign	Het
Trps1	T	C	15: 50,664,743	N725D	probably damaging	Het
Ttn	C	T	2: 76,814,806	V12902M	probably damaging	Het
Ubxn4	G	A	1: 128,262,904	E256K	probably benign	Het
Unc79	A	G	12: 103,112,891	K1772E	probably damaging	Het
Vwde	C	T	6: 13,193,126	V405I	probably benign	Het
Wdr18	T	A	10: 79,966,408	D290E	probably damaging	Het
Wdr92	T	C	11: 17,229,851	L284P	probably damaging	Het
Wwc2	G	A	8: 47,900,721	A126V	probably benign	Het
Zfp882	A	T	8: 71,913,523	I105F	possibly damaging	Het
Zfp942	A	T	17: 21,928,572	C359S	probably benign	Het

Other mutations in Itga1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Itga1	APN	13	114992363	missense	possibly damaging	0.80
IGL00498:Itga1	APN	13	115031193	missense	probably benign	0.00
IGL00549:Itga1	APN	13	115049296	missense	possibly damaging	0.92
IGL00587:Itga1	APN	13	115012249	missense	probably damaging	1.00
IGL01021:Itga1	APN	13	114997000	missense	probably benign	0.29
IGL01289:Itga1	APN	13	114986226	missense	possibly damaging	0.79
IGL01636:Itga1	APN	13	115006948	missense	possibly damaging	0.73
IGL01791:Itga1	APN	13	114987661	missense	probably benign	0.00
IGL01796:Itga1	APN	13	114985121	missense	probably damaging	1.00
IGL02027:Itga1	APN	13	114990055	splice site	probably null
IGL02330:Itga1	APN	13	115012204	missense	probably damaging	1.00
IGL02480:Itga1	APN	13	114987648	missense	probably damaging	1.00
IGL02943:Itga1	APN	13	115049296	missense	possibly damaging	0.92
R0103:Itga1	UTSW	13	115016254	missense	probably benign	0.40
R0103:Itga1	UTSW	13	115016254	missense	probably benign	0.40
R0265:Itga1	UTSW	13	114992459	missense	probably benign
R0302:Itga1	UTSW	13	115012318	splice site	probably benign
R0320:Itga1	UTSW	13	114977594	splice site	probably benign
R0389:Itga1	UTSW	13	114992460	missense	probably benign	0.04
R0443:Itga1	UTSW	13	114992460	missense	probably benign	0.04
R0574:Itga1	UTSW	13	114966561	missense	probably damaging	1.00
R0646:Itga1	UTSW	13	114968299	missense	probably benign
R0830:Itga1	UTSW	13	115007032	missense	probably benign	0.08
R2162:Itga1	UTSW	13	115030910	missense	probably benign	0.23
R2216:Itga1	UTSW	13	114997029	missense	probably benign	0.00
R2403:Itga1	UTSW	13	114977614	missense	probably benign	0.00
R3734:Itga1	UTSW	13	114977639	missense	probably benign
R4171:Itga1	UTSW	13	115030886	nonsense	probably null
R4402:Itga1	UTSW	13	115001566	missense	probably benign	0.00
R4675:Itga1	UTSW	13	115001691	splice site	probably null
R4684:Itga1	UTSW	13	115049370	missense	probably damaging	1.00
R4795:Itga1	UTSW	13	115035385	missense	probably damaging	1.00
R4796:Itga1	UTSW	13	115035385	missense	probably damaging	1.00
R4845:Itga1	UTSW	13	114974172	nonsense	probably null
R5147:Itga1	UTSW	13	114985142	missense	possibly damaging	0.91
R5155:Itga1	UTSW	13	115035303	missense	probably benign
R5234:Itga1	UTSW	13	115049303	nonsense	probably null
R5344:Itga1	UTSW	13	115002309	missense	possibly damaging	0.78
R5554:Itga1	UTSW	13	114992474	nonsense	probably null
R5662:Itga1	UTSW	13	114986171	missense	probably benign	0.03
R5945:Itga1	UTSW	13	114966590	missense	probably benign	0.02
R6150:Itga1	UTSW	13	114968233	missense	probably benign	0.01
R6241:Itga1	UTSW	13	114960137	splice site	probably null
R6276:Itga1	UTSW	13	114980852	missense	probably benign
R6369:Itga1	UTSW	13	114965660	missense	probably damaging	1.00
R6511:Itga1	UTSW	13	114992501	missense	probably damaging	0.98
R6663:Itga1	UTSW	13	114974105	missense	probably benign	0.02
R6783:Itga1	UTSW	13	114996977	missense	probably benign	0.22
R6931:Itga1	UTSW	13	115001563	missense	probably benign	0.39
R7069:Itga1	UTSW	13	114968240	missense	probably damaging	1.00
R7458:Itga1	UTSW	13	114986266	missense	probably benign	0.00
R7588:Itga1	UTSW	13	114968249	missense	possibly damaging	0.88
R7591:Itga1	UTSW	13	114982779	missense	probably damaging	1.00
R7597:Itga1	UTSW	13	114974140	missense	probably benign	0.28
R7615:Itga1	UTSW	13	114996922	missense	probably null	0.99
R7756:Itga1	UTSW	13	114992460	missense	probably benign	0.04
R7795:Itga1	UTSW	13	115012236	missense	probably damaging	1.00
R7819:Itga1	UTSW	13	115049301	missense	probably damaging	0.99
R8193:Itga1	UTSW	13	114968455	critical splice donor site	probably null
R8313:Itga1	UTSW	13	114966584	missense	probably benign	0.06
R8419:Itga1	UTSW	13	115007068	missense	probably damaging	1.00
R8925:Itga1	UTSW	13	114968519	missense	probably benign	0.01
R8927:Itga1	UTSW	13	114968519	missense	probably benign	0.01
R8951:Itga1	UTSW	13	114970491	nonsense	probably null
R9099:Itga1	UTSW	13	115049320	missense	probably damaging	1.00
R9200:Itga1	UTSW	13	114968461	missense	possibly damaging	0.80
R9221:Itga1	UTSW	13	115030159	nonsense	probably null
R9249:Itga1	UTSW	13	115049298	missense	probably damaging	1.00
R9267:Itga1	UTSW	13	115049388	missense	possibly damaging	0.50
R9376:Itga1	UTSW	13	114970576	missense	probably benign	0.07
R9481:Itga1	UTSW	13	115016217	missense	probably benign	0.34
R9789:Itga1	UTSW	13	115035284	nonsense	probably null
Z1177:Itga1	UTSW	13	114985071	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGCTGCACATTGTCACAGCCTAAC -3'
(R):5'- GCAGAAGCTAAAATACGCTCTCGCC -3'

Sequencing Primer
(F):5'- TTGTCACAGCCTAACAAAGTCG -3'
(R):5'- TGCTGGACCCTAGATCCTTGG -3'

Posted On

2013-05-23