Incidental Mutation 'R4916:Ppfia2'
ID380089
Institutional Source Beutler Lab
Gene Symbol Ppfia2
Ensembl Gene ENSMUSG00000053825
Gene Nameprotein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
SynonymsLiprin-alpha2, E130120L08Rik
MMRRC Submission 042518-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4916 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location106470339-106935952 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 106762117 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 180 (L180F)
Ref Sequence ENSEMBL: ENSMUSP00000029404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029404] [ENSMUST00000217854]
Predicted Effect probably damaging
Transcript: ENSMUST00000029404
AA Change: L180F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029404
Gene: ENSMUSG00000053825
AA Change: L180F

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
coiled coil region 32 80 N/A INTRINSIC
coiled coil region 102 150 N/A INTRINSIC
coiled coil region 189 234 N/A INTRINSIC
coiled coil region 267 541 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 616 631 N/A INTRINSIC
coiled coil region 643 691 N/A INTRINSIC
low complexity region 702 725 N/A INTRINSIC
SAM 895 964 6.27e-10 SMART
low complexity region 965 977 N/A INTRINSIC
SAM 1017 1084 1.69e-6 SMART
SAM 1105 1177 6.62e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169303
SMART Domains Protein: ENSMUSP00000129642
Gene: ENSMUSG00000053825

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
coiled coil region 32 80 N/A INTRINSIC
coiled coil region 102 150 N/A INTRINSIC
coiled coil region 189 215 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217854
AA Change: L180F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.1244 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. It has been proposed that liprins are multivalent proteins that form complex structures and act as scaffolds for the recruitment and anchoring of LAR family of tyrosine phosphatases. This protein has been shown to bind the calcium/calmodulin-dependent serine protein kinase (MAGUK family) protein (also known as CASK) and proposed to regulate higher-order brain functions in mammals. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930595D18Rik G A 12: 111,174,935 Q19* probably null Het
5430419D17Rik T A 7: 131,174,477 probably null Het
6030468B19Rik T A 11: 117,806,266 C230* probably null Het
A730017C20Rik A T 18: 59,072,205 I22F probably damaging Het
Adcy10 A G 1: 165,518,246 E288G probably damaging Het
Adnp T A 2: 168,187,617 T51S possibly damaging Het
Agap3 C A 5: 24,478,013 A464D probably damaging Het
Ago4 A C 4: 126,506,842 C693G probably damaging Het
Ahi1 A G 10: 20,984,404 R675G probably damaging Het
Amigo1 T A 3: 108,187,665 L160Q probably damaging Het
Ankrd35 T C 3: 96,684,122 S575P probably benign Het
Ano3 T A 2: 110,771,020 T298S possibly damaging Het
Ap2b1 T G 11: 83,390,706 F813V probably damaging Het
Aplnr T G 2: 85,136,917 F95L probably damaging Het
Apobec2 T C 17: 48,423,125 E171G probably benign Het
Ascc1 A G 10: 60,004,862 N15S probably benign Het
AY358078 T A 14: 51,802,651 Y73N unknown Het
B3gnt8 C A 7: 25,628,883 P246Q probably damaging Het
C2cd2l T C 9: 44,316,560 Q250R probably damaging Het
Camk2d T C 3: 126,783,975 Y180H probably damaging Het
Ccdc129 C T 6: 55,978,190 P928S possibly damaging Het
Ccdc170 A G 10: 4,518,971 E167G probably damaging Het
Cdyl2 A G 8: 116,579,187 M445T probably damaging Het
Clca1 T C 3: 145,015,844 D322G probably benign Het
Cnot10 C T 9: 114,629,134 M101I possibly damaging Het
Cntrl C T 2: 35,165,682 T1196M probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcaf6 T C 1: 165,420,205 D153G probably damaging Het
Dennd2c G A 3: 103,131,824 G96E probably benign Het
Dhrs9 T C 2: 69,401,408 F304S probably damaging Het
Dmxl1 T C 18: 49,877,697 S974P probably damaging Het
Dnah6 T C 6: 73,192,676 probably benign Het
Dnah7c T C 1: 46,595,008 L1049P probably damaging Het
Dnajc2 T C 5: 21,757,340 K621E probably damaging Het
Ehbp1 T C 11: 22,146,592 D299G probably benign Het
Erap1 A G 13: 74,646,528 E102G probably benign Het
Fasn T G 11: 120,816,646 N799T probably benign Het
Fbxl20 T C 11: 98,128,360 D22G probably damaging Het
Fgfr1 T C 8: 25,563,526 probably null Het
Frzb A T 2: 80,446,527 I105N probably damaging Het
Gabrb1 T A 5: 71,869,421 F55Y probably damaging Het
Gatd1 G T 7: 141,409,097 C216* probably null Het
Gnl2 A C 4: 125,043,692 N255T probably damaging Het
Golgb1 A T 16: 36,916,118 Q1909L probably benign Het
Gpnmb T C 6: 49,051,970 L474P probably damaging Het
H60b T C 10: 22,287,216 V230A possibly damaging Het
Hmcn2 T A 2: 31,360,980 V818D probably damaging Het
Jade2 G T 11: 51,817,082 T768K probably benign Het
Kif28 T C 1: 179,702,520 H692R probably benign Het
Kmt2b T C 7: 30,578,517 N1634S probably damaging Het
Knop1 A G 7: 118,846,076 W222R probably damaging Het
Lrmp C A 6: 145,165,301 S277R probably damaging Het
Map1b T C 13: 99,433,300 D971G unknown Het
Mapk7 G T 11: 61,493,649 T77K probably damaging Het
Mcm6 A G 1: 128,348,977 L292P probably damaging Het
Megf8 T C 7: 25,339,664 L900P probably benign Het
Meis1 G A 11: 18,881,776 H421Y possibly damaging Het
Mllt1 T C 17: 56,899,813 T344A probably benign Het
Mta1 T A 12: 113,136,540 S657T probably benign Het
Mtus1 C A 8: 41,000,801 K998N probably damaging Het
Ncdn G A 4: 126,749,938 L364F possibly damaging Het
Ndufb7 T C 8: 83,570,905 L63P probably damaging Het
Nfix T C 8: 84,771,829 I172V probably benign Het
Nos1 T C 5: 117,947,570 probably null Het
Nrp1 C A 8: 128,502,804 S921* probably null Het
Olfr1459 T A 19: 13,145,991 I223L possibly damaging Het
Olfr401 A T 11: 74,121,879 I197F probably benign Het
Oma1 T C 4: 103,319,530 probably null Het
Pcp2 T A 8: 3,625,534 probably benign Het
Pdk4 T A 6: 5,489,157 H250L possibly damaging Het
Phldb3 A G 7: 24,624,291 H449R probably benign Het
Pip4k2c T C 10: 127,199,327 T391A possibly damaging Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Prkcg T G 7: 3,330,265 Y624* probably null Het
Psmg2 A G 18: 67,648,856 E164G probably damaging Het
Rb1 A T 14: 73,216,691 L589H probably damaging Het
Rcvrn A T 11: 67,695,765 I117F probably damaging Het
Rere T A 4: 150,619,144 W1528R probably damaging Het
Robo2 A G 16: 73,898,915 S1447P possibly damaging Het
Scfd2 C A 5: 74,462,658 G405W probably damaging Het
Scin T A 12: 40,069,374 I552F possibly damaging Het
Serpina3k G A 12: 104,343,010 V238M probably damaging Het
Slc1a6 G A 10: 78,796,251 V304M probably damaging Het
Slc20a2 C T 8: 22,561,004 S351L probably damaging Het
Slc31a2 T C 4: 62,297,088 V124A probably damaging Het
Slc38a3 T C 9: 107,656,227 N244S probably benign Het
Slc4a1 A G 11: 102,352,453 V784A probably damaging Het
Slc6a5 T C 7: 49,948,256 F623L probably benign Het
Slf2 T G 19: 44,971,661 D1022E probably damaging Het
Slfn8 G A 11: 83,016,878 H280Y probably damaging Het
Smpdl3a A T 10: 57,801,031 D45V probably damaging Het
Ssh3 T C 19: 4,265,142 E342G probably damaging Het
Tacr1 A T 6: 82,554,941 I273F probably benign Het
Tfg T A 16: 56,694,396 probably null Het
Tmem179 A G 12: 112,501,834 L71P probably damaging Het
Tmem63a T A 1: 180,966,521 I541N probably benign Het
Traj20 G A 14: 54,199,467 probably benign Het
Trappc13 A T 13: 104,154,294 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tulp1 A G 17: 28,359,135 L310P probably damaging Het
Ube2cbp A G 9: 86,422,872 Y306H probably damaging Het
Urb1 A T 16: 90,783,328 V649E probably damaging Het
Vps13d A G 4: 144,983,393 L4211P probably damaging Het
Vwa5b1 T A 4: 138,594,262 I407F possibly damaging Het
Vwce G T 19: 10,646,879 C378F probably damaging Het
Zfp791 T A 8: 85,110,951 I95L probably benign Het
Other mutations in Ppfia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Ppfia2 APN 10 106819492 missense probably benign 0.25
IGL01296:Ppfia2 APN 10 106858207 missense probably damaging 0.98
IGL01385:Ppfia2 APN 10 106913699 missense probably damaging 1.00
IGL01592:Ppfia2 APN 10 106836048 splice site probably benign
IGL01899:Ppfia2 APN 10 106915751 critical splice donor site probably null
IGL02063:Ppfia2 APN 10 106904845 missense probably null 0.83
IGL02143:Ppfia2 APN 10 106857499 missense probably damaging 1.00
IGL02170:Ppfia2 APN 10 106800785 missense probably benign
IGL02565:Ppfia2 APN 10 106863386 critical splice donor site probably null
IGL02573:Ppfia2 APN 10 106828928 missense probably damaging 1.00
IGL02819:Ppfia2 APN 10 106906394 missense probably damaging 1.00
IGL02974:Ppfia2 APN 10 106800776 missense probably benign 0.08
IGL03165:Ppfia2 APN 10 106767487 missense probably damaging 1.00
IGL03255:Ppfia2 APN 10 106896507 missense possibly damaging 0.76
PIT4458001:Ppfia2 UTSW 10 106927847 missense probably benign 0.24
R0018:Ppfia2 UTSW 10 106842786 splice site probably benign
R0018:Ppfia2 UTSW 10 106842786 splice site probably benign
R0323:Ppfia2 UTSW 10 106896420 missense possibly damaging 0.84
R0391:Ppfia2 UTSW 10 106830714 splice site probably benign
R0667:Ppfia2 UTSW 10 106913694 missense probably damaging 0.97
R0782:Ppfia2 UTSW 10 106927731 missense probably benign 0.32
R0905:Ppfia2 UTSW 10 106819511 missense probably benign 0.43
R1401:Ppfia2 UTSW 10 106830657 missense possibly damaging 0.94
R1672:Ppfia2 UTSW 10 106830568 missense possibly damaging 0.53
R1723:Ppfia2 UTSW 10 106915672 splice site probably null
R1780:Ppfia2 UTSW 10 106896507 missense possibly damaging 0.76
R1847:Ppfia2 UTSW 10 106927710 missense probably benign 0.16
R2015:Ppfia2 UTSW 10 106474677 missense probably benign 0.01
R2051:Ppfia2 UTSW 10 106837299 missense probably damaging 0.98
R2061:Ppfia2 UTSW 10 106837329 missense possibly damaging 0.94
R2115:Ppfia2 UTSW 10 106762111 missense probably damaging 1.00
R2310:Ppfia2 UTSW 10 106854980 missense probably damaging 0.99
R2394:Ppfia2 UTSW 10 106819490 missense probably damaging 0.99
R2656:Ppfia2 UTSW 10 106865407 splice site probably null
R3113:Ppfia2 UTSW 10 106906395 nonsense probably null
R3968:Ppfia2 UTSW 10 106906521 missense probably damaging 0.99
R3977:Ppfia2 UTSW 10 106830629 missense possibly damaging 0.69
R3978:Ppfia2 UTSW 10 106830629 missense possibly damaging 0.69
R3979:Ppfia2 UTSW 10 106830629 missense possibly damaging 0.69
R4567:Ppfia2 UTSW 10 106865406 splice site probably null
R4632:Ppfia2 UTSW 10 106836044 splice site probably null
R4718:Ppfia2 UTSW 10 106858285 missense probably damaging 1.00
R4758:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R4770:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R4810:Ppfia2 UTSW 10 106915690 missense probably benign 0.01
R4841:Ppfia2 UTSW 10 106854957 missense probably benign 0.04
R4842:Ppfia2 UTSW 10 106854957 missense probably benign 0.04
R4914:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R4917:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R5014:Ppfia2 UTSW 10 106865363 nonsense probably null
R5029:Ppfia2 UTSW 10 106857443 missense probably benign 0.04
R5127:Ppfia2 UTSW 10 106835760 missense probably damaging 0.99
R5357:Ppfia2 UTSW 10 106904847 critical splice donor site probably null
R5420:Ppfia2 UTSW 10 106835701 missense possibly damaging 0.88
R6030:Ppfia2 UTSW 10 106906477 missense probably damaging 1.00
R6030:Ppfia2 UTSW 10 106906477 missense probably damaging 1.00
R6135:Ppfia2 UTSW 10 106857569 missense probably damaging 1.00
R6237:Ppfia2 UTSW 10 106913594 missense probably damaging 1.00
R6433:Ppfia2 UTSW 10 106913698 missense possibly damaging 0.94
R6457:Ppfia2 UTSW 10 106893500 missense probably damaging 1.00
R6542:Ppfia2 UTSW 10 106835725 missense probably damaging 0.99
R6674:Ppfia2 UTSW 10 106927772 missense probably benign 0.23
R6746:Ppfia2 UTSW 10 106906458 nonsense probably null
R6992:Ppfia2 UTSW 10 106474854 missense possibly damaging 0.88
R7060:Ppfia2 UTSW 10 106762109 missense probably damaging 1.00
R7346:Ppfia2 UTSW 10 106857495 missense possibly damaging 0.79
R7453:Ppfia2 UTSW 10 106927830 missense possibly damaging 0.82
R7555:Ppfia2 UTSW 10 106927826 missense probably benign 0.00
R7622:Ppfia2 UTSW 10 106830659 missense possibly damaging 0.86
R7637:Ppfia2 UTSW 10 106865403 critical splice donor site probably null
X0021:Ppfia2 UTSW 10 106474677 missense probably benign 0.06
X0022:Ppfia2 UTSW 10 106893434 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGTGCCTGCTTAAACTAAC -3'
(R):5'- GATTATGCCTCTGGACACGG -3'

Sequencing Primer
(F):5'- TTGTGTCCCGACATGAAC -3'
(R):5'- CGGATTGGCCTGAAATCA -3'
Posted On2016-04-15