Mutagenetix > Incidental Mutation

Incidental Mutation 'R4916:Map1b'

380116

Institutional Source

Beutler Lab

Gene Symbol

Map1b

Ensembl Gene

ENSMUSG00000052727

Gene Name

microtubule-associated protein 1B

Synonyms

Mtap1b, MAP5, Mtap-5, Mtap5, LC1

MMRRC Submission

042518-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4916 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

99421446-99516540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 99433300 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 971 (D971G)

Ref Sequence

ENSEMBL: ENSMUSP00000068374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064762]

AlphaFold

P14873

Predicted Effect

unknown
Transcript: ENSMUST00000064762
AA Change: D971G

SMART Domains

Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: D971G

Domain	Start	End	E-Value	Type
low complexity region	41	50	N/A	INTRINSIC
Blast:Lactamase_B	270	514	1e-56	BLAST
low complexity region	578	595	N/A	INTRINSIC
low complexity region	597	617	N/A	INTRINSIC
SCOP:d1gkub2	633	735	8e-4	SMART
low complexity region	771	813	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	889	913	N/A	INTRINSIC
low complexity region	935	956	N/A	INTRINSIC
low complexity region	1006	1030	N/A	INTRINSIC
low complexity region	1247	1261	N/A	INTRINSIC
low complexity region	1390	1404	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
low complexity region	1724	1735	N/A	INTRINSIC
Pfam:MAP1B_neuraxin	1891	1907	1.9e-10	PFAM
Pfam:MAP1B_neuraxin	1908	1924	8.3e-11	PFAM
Pfam:MAP1B_neuraxin	1942	1958	3.1e-9	PFAM
Pfam:MAP1B_neuraxin	1959	1975	6.2e-9	PFAM
Pfam:MAP1B_neuraxin	2027	2043	2.9e-10	PFAM
Pfam:MAP1B_neuraxin	2044	2060	3.9e-9	PFAM
low complexity region	2227	2257	N/A	INTRINSIC
low complexity region	2286	2307	N/A	INTRINSIC
low complexity region	2316	2343	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223693

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224702

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.9%
20x: 91.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 106 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930595D18Rik	G	A	12: 111,174,935	Q19*	probably null	Het
5430419D17Rik	T	A	7: 131,174,477		probably null	Het
6030468B19Rik	T	A	11: 117,806,266	C230*	probably null	Het
A730017C20Rik	A	T	18: 59,072,205	I22F	probably damaging	Het
Adcy10	A	G	1: 165,518,246	E288G	probably damaging	Het
Adnp	T	A	2: 168,187,617	T51S	possibly damaging	Het
Agap3	C	A	5: 24,478,013	A464D	probably damaging	Het
Ago4	A	C	4: 126,506,842	C693G	probably damaging	Het
Ahi1	A	G	10: 20,984,404	R675G	probably damaging	Het
Amigo1	T	A	3: 108,187,665	L160Q	probably damaging	Het
Ankrd35	T	C	3: 96,684,122	S575P	probably benign	Het
Ano3	T	A	2: 110,771,020	T298S	possibly damaging	Het
Ap2b1	T	G	11: 83,390,706	F813V	probably damaging	Het
Aplnr	T	G	2: 85,136,917	F95L	probably damaging	Het
Apobec2	T	C	17: 48,423,125	E171G	probably benign	Het
Ascc1	A	G	10: 60,004,862	N15S	probably benign	Het
AY358078	T	A	14: 51,802,651	Y73N	unknown	Het
B3gnt8	C	A	7: 25,628,883	P246Q	probably damaging	Het
C2cd2l	T	C	9: 44,316,560	Q250R	probably damaging	Het
Camk2d	T	C	3: 126,783,975	Y180H	probably damaging	Het
Ccdc129	C	T	6: 55,978,190	P928S	possibly damaging	Het
Ccdc170	A	G	10: 4,518,971	E167G	probably damaging	Het
Cdyl2	A	G	8: 116,579,187	M445T	probably damaging	Het
Clca1	T	C	3: 145,015,844	D322G	probably benign	Het
Cnot10	C	T	9: 114,629,134	M101I	possibly damaging	Het
Cntrl	C	T	2: 35,165,682	T1196M	probably benign	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Dcaf6	T	C	1: 165,420,205	D153G	probably damaging	Het
Dennd2c	G	A	3: 103,131,824	G96E	probably benign	Het
Dhrs9	T	C	2: 69,401,408	F304S	probably damaging	Het
Dmxl1	T	C	18: 49,877,697	S974P	probably damaging	Het
Dnah6	T	C	6: 73,192,676		probably benign	Het
Dnah7c	T	C	1: 46,595,008	L1049P	probably damaging	Het
Dnajc2	T	C	5: 21,757,340	K621E	probably damaging	Het
Ehbp1	T	C	11: 22,146,592	D299G	probably benign	Het
Erap1	A	G	13: 74,646,528	E102G	probably benign	Het
Fasn	T	G	11: 120,816,646	N799T	probably benign	Het
Fbxl20	T	C	11: 98,128,360	D22G	probably damaging	Het
Fgfr1	T	C	8: 25,563,526		probably null	Het
Frzb	A	T	2: 80,446,527	I105N	probably damaging	Het
Gabrb1	T	A	5: 71,869,421	F55Y	probably damaging	Het
Gatd1	G	T	7: 141,409,097	C216*	probably null	Het
Gnl2	A	C	4: 125,043,692	N255T	probably damaging	Het
Golgb1	A	T	16: 36,916,118	Q1909L	probably benign	Het
Gpnmb	T	C	6: 49,051,970	L474P	probably damaging	Het
H60b	T	C	10: 22,287,216	V230A	possibly damaging	Het
Hmcn2	T	A	2: 31,360,980	V818D	probably damaging	Het
Jade2	G	T	11: 51,817,082	T768K	probably benign	Het
Kif28	T	C	1: 179,702,520	H692R	probably benign	Het
Kmt2b	T	C	7: 30,578,517	N1634S	probably damaging	Het
Knop1	A	G	7: 118,846,076	W222R	probably damaging	Het
Lrmp	C	A	6: 145,165,301	S277R	probably damaging	Het
Mapk7	G	T	11: 61,493,649	T77K	probably damaging	Het
Mcm6	A	G	1: 128,348,977	L292P	probably damaging	Het
Megf8	T	C	7: 25,339,664	L900P	probably benign	Het
Meis1	G	A	11: 18,881,776	H421Y	possibly damaging	Het
Mllt1	T	C	17: 56,899,813	T344A	probably benign	Het
Mta1	T	A	12: 113,136,540	S657T	probably benign	Het
Mtus1	C	A	8: 41,000,801	K998N	probably damaging	Het
Ncdn	G	A	4: 126,749,938	L364F	possibly damaging	Het
Ndufb7	T	C	8: 83,570,905	L63P	probably damaging	Het
Nfix	T	C	8: 84,771,829	I172V	probably benign	Het
Nos1	T	C	5: 117,947,570		probably null	Het
Nrp1	C	A	8: 128,502,804	S921*	probably null	Het
Olfr1459	T	A	19: 13,145,991	I223L	possibly damaging	Het
Olfr401	A	T	11: 74,121,879	I197F	probably benign	Het
Oma1	T	C	4: 103,319,530		probably null	Het
Pcp2	T	A	8: 3,625,534		probably benign	Het
Pdk4	T	A	6: 5,489,157	H250L	possibly damaging	Het
Phldb3	A	G	7: 24,624,291	H449R	probably benign	Het
Pip4k2c	T	C	10: 127,199,327	T391A	possibly damaging	Het
Polrmt	A	G	10: 79,746,551	M1T	probably null	Het
Ppfia2	G	C	10: 106,762,117	L180F	probably damaging	Het
Prkcg	T	G	7: 3,330,265	Y624*	probably null	Het
Psmg2	A	G	18: 67,648,856	E164G	probably damaging	Het
Rb1	A	T	14: 73,216,691	L589H	probably damaging	Het
Rcvrn	A	T	11: 67,695,765	I117F	probably damaging	Het
Rere	T	A	4: 150,619,144	W1528R	probably damaging	Het
Robo2	A	G	16: 73,898,915	S1447P	possibly damaging	Het
Scfd2	C	A	5: 74,462,658	G405W	probably damaging	Het
Scin	T	A	12: 40,069,374	I552F	possibly damaging	Het
Serpina3k	G	A	12: 104,343,010	V238M	probably damaging	Het
Slc1a6	G	A	10: 78,796,251	V304M	probably damaging	Het
Slc20a2	C	T	8: 22,561,004	S351L	probably damaging	Het
Slc31a2	T	C	4: 62,297,088	V124A	probably damaging	Het
Slc38a3	T	C	9: 107,656,227	N244S	probably benign	Het
Slc4a1	A	G	11: 102,352,453	V784A	probably damaging	Het
Slc6a5	T	C	7: 49,948,256	F623L	probably benign	Het
Slf2	T	G	19: 44,971,661	D1022E	probably damaging	Het
Slfn8	G	A	11: 83,016,878	H280Y	probably damaging	Het
Smpdl3a	A	T	10: 57,801,031	D45V	probably damaging	Het
Ssh3	T	C	19: 4,265,142	E342G	probably damaging	Het
Tacr1	A	T	6: 82,554,941	I273F	probably benign	Het
Tfg	T	A	16: 56,694,396		probably null	Het
Tmem179	A	G	12: 112,501,834	L71P	probably damaging	Het
Tmem63a	T	A	1: 180,966,521	I541N	probably benign	Het
Traj20	G	A	14: 54,199,467		probably benign	Het
Trappc13	A	T	13: 104,154,294		probably null	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Tulp1	A	G	17: 28,359,135	L310P	probably damaging	Het
Ube2cbp	A	G	9: 86,422,872	Y306H	probably damaging	Het
Urb1	A	T	16: 90,783,328	V649E	probably damaging	Het
Vps13d	A	G	4: 144,983,393	L4211P	probably damaging	Het
Vwa5b1	T	A	4: 138,594,262	I407F	possibly damaging	Het
Vwce	G	T	19: 10,646,879	C378F	probably damaging	Het
Zfp791	T	A	8: 85,110,951	I95L	probably benign	Het

Other mutations in Map1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Map1b	APN	13	99429233	missense	unknown
IGL00533:Map1b	APN	13	99432604	missense	unknown
IGL00801:Map1b	APN	13	99430097	missense	unknown
IGL01141:Map1b	APN	13	99434761	missense	probably damaging	1.00
IGL01418:Map1b	APN	13	99431830	missense	unknown
IGL01464:Map1b	APN	13	99432743	missense	unknown
IGL01690:Map1b	APN	13	99435004	missense	probably damaging	1.00
IGL01991:Map1b	APN	13	99429569	missense	unknown
IGL02245:Map1b	APN	13	99431528	missense	unknown
IGL02376:Map1b	APN	13	99435595	missense	probably damaging	1.00
IGL02380:Map1b	APN	13	99431143	missense	unknown
IGL02442:Map1b	APN	13	99508198	missense	probably damaging	1.00
IGL02465:Map1b	APN	13	99433406	missense	unknown
IGL02816:Map1b	APN	13	99441755	missense	probably damaging	1.00
IGL02859:Map1b	APN	13	99433036	missense	unknown
IGL02934:Map1b	APN	13	99435131	missense	probably benign	0.09
IGL02970:Map1b	APN	13	99430734	nonsense	probably null
IGL03148:Map1b	APN	13	99441695	missense	probably damaging	1.00
IGL03401:Map1b	APN	13	99427268	missense	unknown
IGL03138:Map1b	UTSW	13	99425826	missense	unknown
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0035:Map1b	UTSW	13	99435338	missense	probably damaging	1.00
R0069:Map1b	UTSW	13	99429848	missense	unknown
R0315:Map1b	UTSW	13	99431116	missense	unknown
R0539:Map1b	UTSW	13	99434018	missense	unknown
R0548:Map1b	UTSW	13	99431683	missense	unknown
R0613:Map1b	UTSW	13	99441641	missense	probably damaging	1.00
R0730:Map1b	UTSW	13	99429766	nonsense	probably null
R1103:Map1b	UTSW	13	99427466	splice site	probably benign
R1300:Map1b	UTSW	13	99432521	missense	unknown
R1353:Map1b	UTSW	13	99427326	missense	unknown
R1387:Map1b	UTSW	13	99432650	missense	unknown
R1481:Map1b	UTSW	13	99431171	missense	unknown
R1509:Map1b	UTSW	13	99431528	missense	unknown
R1521:Map1b	UTSW	13	99432739	missense	unknown
R1604:Map1b	UTSW	13	99429572	missense	unknown
R1649:Map1b	UTSW	13	99516478	missense	probably benign	0.03
R1651:Map1b	UTSW	13	99432583	missense	unknown
R1661:Map1b	UTSW	13	99431929	missense	unknown
R1665:Map1b	UTSW	13	99431929	missense	unknown
R1770:Map1b	UTSW	13	99430493	missense	unknown
R1926:Map1b	UTSW	13	99430692	missense	unknown
R1928:Map1b	UTSW	13	99430946	missense	unknown
R2093:Map1b	UTSW	13	99429670	missense	unknown
R2110:Map1b	UTSW	13	99431121	missense	unknown
R2116:Map1b	UTSW	13	99430644	missense	unknown
R2164:Map1b	UTSW	13	99429338	missense	unknown
R2207:Map1b	UTSW	13	99431083	missense	unknown
R2273:Map1b	UTSW	13	99432084	missense	unknown
R2443:Map1b	UTSW	13	99430411	missense	unknown
R3054:Map1b	UTSW	13	99432742	missense	unknown
R3766:Map1b	UTSW	13	99434087	missense	unknown
R3911:Map1b	UTSW	13	99431072	missense	unknown
R4005:Map1b	UTSW	13	99429907	missense	unknown
R4130:Map1b	UTSW	13	99431680	missense	unknown
R4513:Map1b	UTSW	13	99444233	missense	probably damaging	1.00
R4613:Map1b	UTSW	13	99430302	nonsense	probably null
R4633:Map1b	UTSW	13	99434942	missense	probably damaging	1.00
R4646:Map1b	UTSW	13	99432469	missense	unknown
R4690:Map1b	UTSW	13	99431068	missense	unknown
R4704:Map1b	UTSW	13	99430475	missense	unknown
R4836:Map1b	UTSW	13	99431054	missense	unknown
R4951:Map1b	UTSW	13	99432427	missense	unknown
R4960:Map1b	UTSW	13	99432212	missense	probably benign	0.23
R4961:Map1b	UTSW	13	99435653	missense	probably damaging	1.00
R5030:Map1b	UTSW	13	99434174	missense	unknown
R5090:Map1b	UTSW	13	99430026	nonsense	probably null
R5469:Map1b	UTSW	13	99429338	missense	unknown
R5820:Map1b	UTSW	13	99432824	missense	unknown
R5885:Map1b	UTSW	13	99430081	missense	unknown
R5915:Map1b	UTSW	13	99430331	missense	unknown
R5923:Map1b	UTSW	13	99433153	missense	unknown
R6063:Map1b	UTSW	13	99431137	missense	unknown
R6102:Map1b	UTSW	13	99425873	missense	unknown
R6218:Map1b	UTSW	13	99433206	missense	unknown
R6435:Map1b	UTSW	13	99516363	missense	probably damaging	0.99
R6663:Map1b	UTSW	13	99430022	missense	unknown
R6765:Map1b	UTSW	13	99425941	missense	unknown
R6860:Map1b	UTSW	13	99434767	missense	probably damaging	1.00
R6997:Map1b	UTSW	13	99430634	missense	unknown
R7001:Map1b	UTSW	13	99430593	missense	unknown
R7310:Map1b	UTSW	13	99433655	missense	unknown
R7349:Map1b	UTSW	13	99433640	missense	unknown
R7448:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7449:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7452:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7810:Map1b	UTSW	13	99431882	missense	unknown
R7820:Map1b	UTSW	13	99431177	missense	unknown
R8396:Map1b	UTSW	13	99434113	missense	unknown
R8470:Map1b	UTSW	13	99516442	missense	probably damaging	0.98
R8535:Map1b	UTSW	13	99435154	missense	probably damaging	1.00
R8777:Map1b	UTSW	13	99430796	missense	unknown
R8777-TAIL:Map1b	UTSW	13	99430796	missense	unknown
R8812:Map1b	UTSW	13	99432815	missense	unknown
R8903:Map1b	UTSW	13	99432509	nonsense	probably null
R8928:Map1b	UTSW	13	99432116	missense	unknown
R8954:Map1b	UTSW	13	99434227	missense	unknown
R9164:Map1b	UTSW	13	99425843	missense	unknown
R9164:Map1b	UTSW	13	99432308	nonsense	probably null
R9190:Map1b	UTSW	13	99435406	missense	probably damaging	0.99
R9334:Map1b	UTSW	13	99431640	missense	unknown
R9339:Map1b	UTSW	13	99431062	missense	unknown
R9357:Map1b	UTSW	13	99430200	nonsense	probably null
R9430:Map1b	UTSW	13	99434108	missense	unknown
RF003:Map1b	UTSW	13	99430750	missense	unknown
X0019:Map1b	UTSW	13	99429968	missense	unknown
X0019:Map1b	UTSW	13	99432412	missense	unknown
Z1088:Map1b	UTSW	13	99508115	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- AAGATGCAGGTTCTCGGCTAG -3'
(R):5'- AGTGTGAGCAAACCCCTGAG -3'

Sequencing Primer
(F):5'- TCTCGGCTAGGAGACTGGATTCC -3'
(R):5'- AGCAAACCCCTGAGGAGCTG -3'

Posted On

2016-04-15