Incidental Mutation 'R4916:Golgb1'
ID 380120
Institutional Source Beutler Lab
Gene Symbol Golgb1
Ensembl Gene ENSMUSG00000034243
Gene Name golgin B1
Synonyms C130074L01Rik, Gm6840, F730017E11Rik, Giantin, 6330407A06Rik
MMRRC Submission 042518-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.918) question?
Stock # R4916 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 36695502-36753447 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 36736480 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 1909 (Q1909L)
Ref Sequence ENSEMBL: ENSMUSP00000110460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039855] [ENSMUST00000114812]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039855
AA Change: Q1950L

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000045239
Gene: ENSMUSG00000034243
AA Change: Q1950L

DomainStartEndE-ValueType
internal_repeat_2 24 61 7.47e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
coiled coil region 130 219 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
internal_repeat_3 519 558 7.47e-6 PROSPERO
coiled coil region 563 594 N/A INTRINSIC
internal_repeat_4 627 661 3.38e-5 PROSPERO
coiled coil region 679 1121 N/A INTRINSIC
coiled coil region 1153 1240 N/A INTRINSIC
internal_repeat_4 1253 1288 3.38e-5 PROSPERO
low complexity region 1300 1314 N/A INTRINSIC
internal_repeat_1 1321 1352 3.51e-6 PROSPERO
low complexity region 1357 1369 N/A INTRINSIC
coiled coil region 1402 1755 N/A INTRINSIC
internal_repeat_2 1760 1798 7.47e-6 PROSPERO
internal_repeat_3 1761 1804 7.47e-6 PROSPERO
coiled coil region 1818 2034 N/A INTRINSIC
low complexity region 2291 2306 N/A INTRINSIC
internal_repeat_1 2351 2382 3.51e-6 PROSPERO
low complexity region 2400 2418 N/A INTRINSIC
low complexity region 2538 2549 N/A INTRINSIC
coiled coil region 2775 2827 N/A INTRINSIC
coiled coil region 2854 2943 N/A INTRINSIC
low complexity region 2964 2976 N/A INTRINSIC
coiled coil region 3007 3057 N/A INTRINSIC
coiled coil region 3117 3163 N/A INTRINSIC
transmembrane domain 3215 3237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114812
AA Change: Q1909L

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000110460
Gene: ENSMUSG00000034243
AA Change: Q1909L

DomainStartEndE-ValueType
internal_repeat_2 24 61 6.71e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
low complexity region 143 154 N/A INTRINSIC
low complexity region 200 219 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
internal_repeat_3 478 517 6.71e-6 PROSPERO
coiled coil region 522 553 N/A INTRINSIC
internal_repeat_4 586 620 3.05e-5 PROSPERO
coiled coil region 638 1080 N/A INTRINSIC
coiled coil region 1112 1199 N/A INTRINSIC
internal_repeat_4 1212 1247 3.05e-5 PROSPERO
low complexity region 1259 1273 N/A INTRINSIC
internal_repeat_1 1280 1311 3.14e-6 PROSPERO
low complexity region 1316 1328 N/A INTRINSIC
coiled coil region 1361 1714 N/A INTRINSIC
internal_repeat_2 1719 1757 6.71e-6 PROSPERO
internal_repeat_3 1720 1763 6.71e-6 PROSPERO
coiled coil region 1777 1993 N/A INTRINSIC
low complexity region 2250 2265 N/A INTRINSIC
internal_repeat_1 2310 2341 3.14e-6 PROSPERO
low complexity region 2359 2377 N/A INTRINSIC
low complexity region 2497 2508 N/A INTRINSIC
coiled coil region 2734 2786 N/A INTRINSIC
coiled coil region 2813 2902 N/A INTRINSIC
low complexity region 2923 2935 N/A INTRINSIC
coiled coil region 2966 3016 N/A INTRINSIC
coiled coil region 3076 3122 N/A INTRINSIC
transmembrane domain 3174 3196 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout affects glycosylation of glycoproteins in the extra-cellular matrix of the palatal shelves, resulting in their failure to elevate and fuse, leading to cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930595D18Rik G A 12: 111,141,369 (GRCm39) Q19* probably null Het
6030468B19Rik T A 11: 117,697,092 (GRCm39) C230* probably null Het
Adcy10 A G 1: 165,345,815 (GRCm39) E288G probably damaging Het
Adnp T A 2: 168,029,537 (GRCm39) T51S possibly damaging Het
Agap3 C A 5: 24,683,011 (GRCm39) A464D probably damaging Het
Ago4 A C 4: 126,400,635 (GRCm39) C693G probably damaging Het
Ahi1 A G 10: 20,860,303 (GRCm39) R675G probably damaging Het
Amigo1 T A 3: 108,094,981 (GRCm39) L160Q probably damaging Het
Ankrd35 T C 3: 96,591,438 (GRCm39) S575P probably benign Het
Ano3 T A 2: 110,601,365 (GRCm39) T298S possibly damaging Het
Ap2b1 T G 11: 83,281,532 (GRCm39) F813V probably damaging Het
Aplnr T G 2: 84,967,261 (GRCm39) F95L probably damaging Het
Apobec2 T C 17: 48,730,153 (GRCm39) E171G probably benign Het
Ascc1 A G 10: 59,840,684 (GRCm39) N15S probably benign Het
AY358078 T A 14: 52,040,108 (GRCm39) Y73N unknown Het
B3gnt8 C A 7: 25,328,308 (GRCm39) P246Q probably damaging Het
C2cd2l T C 9: 44,227,857 (GRCm39) Q250R probably damaging Het
Camk2d T C 3: 126,577,624 (GRCm39) Y180H probably damaging Het
Ccdc170 A G 10: 4,468,971 (GRCm39) E167G probably damaging Het
Cdcp3 T A 7: 130,776,206 (GRCm39) probably null Het
Cdyl2 A G 8: 117,305,926 (GRCm39) M445T probably damaging Het
Clca3a1 T C 3: 144,721,605 (GRCm39) D322G probably benign Het
Cnot10 C T 9: 114,458,202 (GRCm39) M101I possibly damaging Het
Cntrl C T 2: 35,055,694 (GRCm39) T1196M probably benign Het
Cybb C G X: 9,316,989 (GRCm39) D246H probably benign Het
Dcaf6 T C 1: 165,247,774 (GRCm39) D153G probably damaging Het
Dennd2c G A 3: 103,039,140 (GRCm39) G96E probably benign Het
Dhrs9 T C 2: 69,231,752 (GRCm39) F304S probably damaging Het
Dmxl1 T C 18: 50,010,764 (GRCm39) S974P probably damaging Het
Dnah6 T C 6: 73,169,659 (GRCm39) probably benign Het
Dnah7c T C 1: 46,634,168 (GRCm39) L1049P probably damaging Het
Dnajc2 T C 5: 21,962,338 (GRCm39) K621E probably damaging Het
Ehbp1 T C 11: 22,096,592 (GRCm39) D299G probably benign Het
Erap1 A G 13: 74,794,647 (GRCm39) E102G probably benign Het
Fasn T G 11: 120,707,472 (GRCm39) N799T probably benign Het
Fbxl20 T C 11: 98,019,186 (GRCm39) D22G probably damaging Het
Fgfr1 T C 8: 26,053,542 (GRCm39) probably null Het
Frzb A T 2: 80,276,871 (GRCm39) I105N probably damaging Het
Gabrb1 T A 5: 72,026,764 (GRCm39) F55Y probably damaging Het
Gatd1 G T 7: 140,989,010 (GRCm39) C216* probably null Het
Gnl2 A C 4: 124,937,485 (GRCm39) N255T probably damaging Het
Gpnmb T C 6: 49,028,904 (GRCm39) L474P probably damaging Het
H60b T C 10: 22,163,115 (GRCm39) V230A possibly damaging Het
Hmcn2 T A 2: 31,250,992 (GRCm39) V818D probably damaging Het
Irag2 C A 6: 145,111,027 (GRCm39) S277R probably damaging Het
Itprid1 C T 6: 55,955,175 (GRCm39) P928S possibly damaging Het
Jade2 G T 11: 51,707,909 (GRCm39) T768K probably benign Het
Kif28 T C 1: 179,530,085 (GRCm39) H692R probably benign Het
Kmt2b T C 7: 30,277,942 (GRCm39) N1634S probably damaging Het
Knop1 A G 7: 118,445,299 (GRCm39) W222R probably damaging Het
Map1b T C 13: 99,569,808 (GRCm39) D971G unknown Het
Mapk7 G T 11: 61,384,475 (GRCm39) T77K probably damaging Het
Mcm6 A G 1: 128,276,714 (GRCm39) L292P probably damaging Het
Megf8 T C 7: 25,039,089 (GRCm39) L900P probably benign Het
Meis1 G A 11: 18,831,776 (GRCm39) H421Y possibly damaging Het
Minar2 A T 18: 59,205,277 (GRCm39) I22F probably damaging Het
Mllt1 T C 17: 57,206,813 (GRCm39) T344A probably benign Het
Mta1 T A 12: 113,100,160 (GRCm39) S657T probably benign Het
Mtus1 C A 8: 41,453,838 (GRCm39) K998N probably damaging Het
Ncdn G A 4: 126,643,731 (GRCm39) L364F possibly damaging Het
Ndufb7 T C 8: 84,297,534 (GRCm39) L63P probably damaging Het
Nfix T C 8: 85,498,458 (GRCm39) I172V probably benign Het
Nos1 T C 5: 118,085,635 (GRCm39) probably null Het
Nrp1 C A 8: 129,229,285 (GRCm39) S921* probably null Het
Oma1 T C 4: 103,176,727 (GRCm39) probably null Het
Or3a1b A T 11: 74,012,705 (GRCm39) I197F probably benign Het
Or5b106 T A 19: 13,123,355 (GRCm39) I223L possibly damaging Het
Pcp2 T A 8: 3,675,534 (GRCm39) probably benign Het
Pdk4 T A 6: 5,489,157 (GRCm39) H250L possibly damaging Het
Phldb3 A G 7: 24,323,716 (GRCm39) H449R probably benign Het
Pip4k2c T C 10: 127,035,196 (GRCm39) T391A possibly damaging Het
Polrmt A G 10: 79,582,385 (GRCm39) M1T probably null Het
Ppfia2 G C 10: 106,597,978 (GRCm39) L180F probably damaging Het
Prkcg T G 7: 3,378,781 (GRCm39) Y624* probably null Het
Psmg2 A G 18: 67,781,926 (GRCm39) E164G probably damaging Het
Rb1 A T 14: 73,454,131 (GRCm39) L589H probably damaging Het
Rcvrn A T 11: 67,586,591 (GRCm39) I117F probably damaging Het
Rere T A 4: 150,703,601 (GRCm39) W1528R probably damaging Het
Robo2 A G 16: 73,695,803 (GRCm39) S1447P possibly damaging Het
Scfd2 C A 5: 74,623,319 (GRCm39) G405W probably damaging Het
Scin T A 12: 40,119,373 (GRCm39) I552F possibly damaging Het
Serpina3k G A 12: 104,309,269 (GRCm39) V238M probably damaging Het
Slc1a6 G A 10: 78,632,085 (GRCm39) V304M probably damaging Het
Slc20a2 C T 8: 23,051,020 (GRCm39) S351L probably damaging Het
Slc31a2 T C 4: 62,215,325 (GRCm39) V124A probably damaging Het
Slc38a3 T C 9: 107,533,426 (GRCm39) N244S probably benign Het
Slc4a1 A G 11: 102,243,279 (GRCm39) V784A probably damaging Het
Slc6a5 T C 7: 49,598,004 (GRCm39) F623L probably benign Het
Slf2 T G 19: 44,960,100 (GRCm39) D1022E probably damaging Het
Slfn8 G A 11: 82,907,704 (GRCm39) H280Y probably damaging Het
Smpdl3a A T 10: 57,677,127 (GRCm39) D45V probably damaging Het
Ssh3 T C 19: 4,315,170 (GRCm39) E342G probably damaging Het
Tacr1 A T 6: 82,531,922 (GRCm39) I273F probably benign Het
Tfg T A 16: 56,514,759 (GRCm39) probably null Het
Tmem179 A G 12: 112,468,268 (GRCm39) L71P probably damaging Het
Tmem63a T A 1: 180,794,086 (GRCm39) I541N probably benign Het
Traj20 G A 14: 54,436,924 (GRCm39) probably benign Het
Trappc13 A T 13: 104,290,802 (GRCm39) probably null Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Tulp1 A G 17: 28,578,109 (GRCm39) L310P probably damaging Het
Ube3d A G 9: 86,304,925 (GRCm39) Y306H probably damaging Het
Urb1 A T 16: 90,580,216 (GRCm39) V649E probably damaging Het
Vps13d A G 4: 144,709,963 (GRCm39) L4211P probably damaging Het
Vwa5b1 T A 4: 138,321,573 (GRCm39) I407F possibly damaging Het
Vwce G T 19: 10,624,243 (GRCm39) C378F probably damaging Het
Zfp791 T A 8: 85,837,580 (GRCm39) I95L probably benign Het
Other mutations in Golgb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Golgb1 APN 16 36,751,926 (GRCm39) missense probably damaging 1.00
IGL01717:Golgb1 APN 16 36,735,864 (GRCm39) nonsense probably null
IGL01965:Golgb1 APN 16 36,738,282 (GRCm39) missense probably damaging 1.00
IGL02128:Golgb1 APN 16 36,736,666 (GRCm39) missense probably damaging 1.00
IGL02268:Golgb1 APN 16 36,733,490 (GRCm39) missense probably benign 0.25
IGL02383:Golgb1 APN 16 36,706,562 (GRCm39) missense probably benign 0.01
IGL02444:Golgb1 APN 16 36,728,178 (GRCm39) splice site probably benign
IGL02635:Golgb1 APN 16 36,735,375 (GRCm39) missense probably benign 0.00
IGL02655:Golgb1 APN 16 36,738,442 (GRCm39) missense probably damaging 0.98
IGL02887:Golgb1 APN 16 36,746,211 (GRCm39) missense probably damaging 0.99
IGL02937:Golgb1 APN 16 36,736,572 (GRCm39) missense probably damaging 1.00
IGL02973:Golgb1 APN 16 36,732,442 (GRCm39) missense possibly damaging 0.92
IGL02982:Golgb1 APN 16 36,746,172 (GRCm39) missense probably damaging 0.98
IGL03065:Golgb1 APN 16 36,733,228 (GRCm39) missense probably benign 0.11
IGL03109:Golgb1 APN 16 36,735,973 (GRCm39) missense possibly damaging 0.93
IGL03323:Golgb1 APN 16 36,733,815 (GRCm39) nonsense probably null
I2288:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
I2289:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
R0071:Golgb1 UTSW 16 36,735,865 (GRCm39) missense probably benign 0.00
R0071:Golgb1 UTSW 16 36,735,865 (GRCm39) missense probably benign 0.00
R0080:Golgb1 UTSW 16 36,718,973 (GRCm39) missense probably damaging 1.00
R0102:Golgb1 UTSW 16 36,695,830 (GRCm39) intron probably benign
R0242:Golgb1 UTSW 16 36,695,992 (GRCm39) nonsense probably null
R0242:Golgb1 UTSW 16 36,695,992 (GRCm39) nonsense probably null
R0276:Golgb1 UTSW 16 36,734,238 (GRCm39) missense probably damaging 1.00
R0394:Golgb1 UTSW 16 36,695,941 (GRCm39) intron probably benign
R0469:Golgb1 UTSW 16 36,751,997 (GRCm39) missense probably benign 0.41
R0522:Golgb1 UTSW 16 36,735,567 (GRCm39) frame shift probably null
R0575:Golgb1 UTSW 16 36,739,171 (GRCm39) missense probably benign
R0600:Golgb1 UTSW 16 36,736,633 (GRCm39) missense probably damaging 1.00
R0608:Golgb1 UTSW 16 36,736,692 (GRCm39) nonsense probably null
R0711:Golgb1 UTSW 16 36,739,152 (GRCm39) missense probably damaging 1.00
R0785:Golgb1 UTSW 16 36,719,152 (GRCm39) missense possibly damaging 0.95
R0893:Golgb1 UTSW 16 36,732,639 (GRCm39) missense possibly damaging 0.64
R1163:Golgb1 UTSW 16 36,736,488 (GRCm39) missense possibly damaging 0.50
R1208:Golgb1 UTSW 16 36,735,567 (GRCm39) frame shift probably null
R1315:Golgb1 UTSW 16 36,735,262 (GRCm39) missense probably benign 0.40
R1429:Golgb1 UTSW 16 36,720,925 (GRCm39) missense possibly damaging 0.93
R1505:Golgb1 UTSW 16 36,740,005 (GRCm39) missense possibly damaging 0.79
R1537:Golgb1 UTSW 16 36,719,150 (GRCm39) missense possibly damaging 0.89
R1610:Golgb1 UTSW 16 36,746,463 (GRCm39) missense probably benign 0.25
R1659:Golgb1 UTSW 16 36,707,979 (GRCm39) missense probably benign 0.01
R1769:Golgb1 UTSW 16 36,736,363 (GRCm39) missense probably damaging 1.00
R2105:Golgb1 UTSW 16 36,735,026 (GRCm39) missense probably benign
R2212:Golgb1 UTSW 16 36,707,709 (GRCm39) missense probably damaging 1.00
R2261:Golgb1 UTSW 16 36,713,722 (GRCm39) missense probably damaging 1.00
R2352:Golgb1 UTSW 16 36,718,921 (GRCm39) missense probably damaging 0.99
R2357:Golgb1 UTSW 16 36,732,370 (GRCm39) missense probably damaging 1.00
R2400:Golgb1 UTSW 16 36,738,828 (GRCm39) missense possibly damaging 0.62
R2513:Golgb1 UTSW 16 36,735,513 (GRCm39) missense possibly damaging 0.73
R3103:Golgb1 UTSW 16 36,715,211 (GRCm39) missense probably damaging 1.00
R3413:Golgb1 UTSW 16 36,707,709 (GRCm39) missense probably damaging 1.00
R3748:Golgb1 UTSW 16 36,739,274 (GRCm39) missense probably benign 0.00
R3847:Golgb1 UTSW 16 36,719,095 (GRCm39) missense probably benign 0.00
R3850:Golgb1 UTSW 16 36,719,095 (GRCm39) missense probably benign 0.00
R3936:Golgb1 UTSW 16 36,734,418 (GRCm39) nonsense probably null
R3975:Golgb1 UTSW 16 36,738,933 (GRCm39) missense probably damaging 0.99
R4025:Golgb1 UTSW 16 36,735,706 (GRCm39) missense probably benign 0.00
R4369:Golgb1 UTSW 16 36,737,269 (GRCm39) missense probably damaging 1.00
R4518:Golgb1 UTSW 16 36,749,625 (GRCm39) missense probably damaging 0.98
R4600:Golgb1 UTSW 16 36,738,987 (GRCm39) missense probably damaging 1.00
R4610:Golgb1 UTSW 16 36,738,987 (GRCm39) missense probably damaging 1.00
R4660:Golgb1 UTSW 16 36,707,980 (GRCm39) missense probably damaging 0.99
R4811:Golgb1 UTSW 16 36,711,781 (GRCm39) missense probably damaging 1.00
R4815:Golgb1 UTSW 16 36,733,477 (GRCm39) missense possibly damaging 0.79
R4835:Golgb1 UTSW 16 36,711,769 (GRCm39) missense possibly damaging 0.86
R4904:Golgb1 UTSW 16 36,713,748 (GRCm39) missense probably damaging 1.00
R5121:Golgb1 UTSW 16 36,739,620 (GRCm39) missense probably damaging 0.99
R5133:Golgb1 UTSW 16 36,711,819 (GRCm39) missense possibly damaging 0.75
R5143:Golgb1 UTSW 16 36,719,051 (GRCm39) missense probably benign 0.09
R5185:Golgb1 UTSW 16 36,695,503 (GRCm39) unclassified probably benign
R5188:Golgb1 UTSW 16 36,738,827 (GRCm39) missense probably benign 0.13
R5260:Golgb1 UTSW 16 36,733,503 (GRCm39) missense probably benign 0.00
R5297:Golgb1 UTSW 16 36,695,978 (GRCm39) intron probably benign
R5386:Golgb1 UTSW 16 36,732,677 (GRCm39) nonsense probably null
R5438:Golgb1 UTSW 16 36,720,870 (GRCm39) missense probably benign 0.15
R5439:Golgb1 UTSW 16 36,720,870 (GRCm39) missense probably benign 0.15
R5494:Golgb1 UTSW 16 36,749,045 (GRCm39) missense possibly damaging 0.67
R5592:Golgb1 UTSW 16 36,746,125 (GRCm39) missense probably benign 0.02
R5740:Golgb1 UTSW 16 36,739,362 (GRCm39) missense probably damaging 0.99
R5862:Golgb1 UTSW 16 36,746,453 (GRCm39) splice site silent
R5928:Golgb1 UTSW 16 36,732,349 (GRCm39) missense probably damaging 1.00
R6009:Golgb1 UTSW 16 36,735,321 (GRCm39) missense probably damaging 1.00
R6062:Golgb1 UTSW 16 36,735,033 (GRCm39) missense possibly damaging 0.89
R6102:Golgb1 UTSW 16 36,733,227 (GRCm39) missense probably damaging 1.00
R6198:Golgb1 UTSW 16 36,713,757 (GRCm39) missense probably damaging 1.00
R6253:Golgb1 UTSW 16 36,735,984 (GRCm39) missense possibly damaging 0.77
R6254:Golgb1 UTSW 16 36,734,340 (GRCm39) missense probably damaging 0.99
R6321:Golgb1 UTSW 16 36,738,559 (GRCm39) nonsense probably null
R6700:Golgb1 UTSW 16 36,695,946 (GRCm39) intron probably benign
R6870:Golgb1 UTSW 16 36,738,565 (GRCm39) missense probably damaging 1.00
R6882:Golgb1 UTSW 16 36,734,352 (GRCm39) missense probably benign
R6944:Golgb1 UTSW 16 36,732,475 (GRCm39) missense probably benign
R7108:Golgb1 UTSW 16 36,734,083 (GRCm39) missense probably benign 0.01
R7124:Golgb1 UTSW 16 36,734,035 (GRCm39) missense probably benign 0.01
R7125:Golgb1 UTSW 16 36,738,325 (GRCm39) missense possibly damaging 0.85
R7187:Golgb1 UTSW 16 36,736,512 (GRCm39) missense probably benign 0.43
R7205:Golgb1 UTSW 16 36,695,663 (GRCm39) missense unknown
R7206:Golgb1 UTSW 16 36,734,111 (GRCm39) missense probably benign 0.41
R7233:Golgb1 UTSW 16 36,735,120 (GRCm39) missense possibly damaging 0.91
R7320:Golgb1 UTSW 16 36,736,313 (GRCm39) nonsense probably null
R7367:Golgb1 UTSW 16 36,718,908 (GRCm39) missense probably benign 0.00
R7408:Golgb1 UTSW 16 36,718,909 (GRCm39) missense probably damaging 0.98
R7419:Golgb1 UTSW 16 36,733,281 (GRCm39) missense possibly damaging 0.95
R7556:Golgb1 UTSW 16 36,736,155 (GRCm39) missense probably benign 0.03
R7599:Golgb1 UTSW 16 36,695,758 (GRCm39) missense unknown
R7673:Golgb1 UTSW 16 36,734,031 (GRCm39) missense probably benign 0.05
R7789:Golgb1 UTSW 16 36,695,761 (GRCm39) missense unknown
R7792:Golgb1 UTSW 16 36,739,092 (GRCm39) missense probably benign 0.43
R7830:Golgb1 UTSW 16 36,719,083 (GRCm39) missense possibly damaging 0.93
R7847:Golgb1 UTSW 16 36,752,282 (GRCm39) missense probably damaging 1.00
R7905:Golgb1 UTSW 16 36,734,047 (GRCm39) missense probably benign
R7944:Golgb1 UTSW 16 36,734,466 (GRCm39) missense probably benign 0.02
R7945:Golgb1 UTSW 16 36,734,466 (GRCm39) missense probably benign 0.02
R7950:Golgb1 UTSW 16 36,735,786 (GRCm39) missense probably benign 0.13
R8040:Golgb1 UTSW 16 36,733,841 (GRCm39) missense possibly damaging 0.85
R8077:Golgb1 UTSW 16 36,738,995 (GRCm39) missense probably damaging 0.99
R8181:Golgb1 UTSW 16 36,737,192 (GRCm39) missense probably damaging 1.00
R8370:Golgb1 UTSW 16 36,732,679 (GRCm39) missense probably benign 0.00
R8684:Golgb1 UTSW 16 36,734,764 (GRCm39) missense possibly damaging 0.92
R8725:Golgb1 UTSW 16 36,739,563 (GRCm39) missense probably damaging 1.00
R8727:Golgb1 UTSW 16 36,739,563 (GRCm39) missense probably damaging 1.00
R8738:Golgb1 UTSW 16 36,736,675 (GRCm39) missense probably damaging 1.00
R8785:Golgb1 UTSW 16 36,740,106 (GRCm39) missense probably damaging 0.99
R8824:Golgb1 UTSW 16 36,736,051 (GRCm39) missense probably benign
R8825:Golgb1 UTSW 16 36,739,809 (GRCm39) missense probably benign 0.00
R8940:Golgb1 UTSW 16 36,736,759 (GRCm39) missense probably damaging 1.00
R8962:Golgb1 UTSW 16 36,733,978 (GRCm39) missense probably damaging 1.00
R9245:Golgb1 UTSW 16 36,739,181 (GRCm39) nonsense probably null
R9365:Golgb1 UTSW 16 36,736,124 (GRCm39) missense probably damaging 1.00
R9612:Golgb1 UTSW 16 36,739,967 (GRCm39) missense probably benign 0.41
R9620:Golgb1 UTSW 16 36,739,811 (GRCm39) missense probably benign
R9691:Golgb1 UTSW 16 36,718,996 (GRCm39) missense probably damaging 1.00
R9747:Golgb1 UTSW 16 36,713,769 (GRCm39) missense probably damaging 1.00
V1662:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
X0067:Golgb1 UTSW 16 36,734,665 (GRCm39) nonsense probably null
Z1088:Golgb1 UTSW 16 36,740,104 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGGAGGAAGAAGTCACC -3'
(R):5'- TACCGGATGCAGTCCTTCTG -3'

Sequencing Primer
(F):5'- TCAGCAGATCCAAGAAGAACTCTG -3'
(R):5'- GCAGTTGCTTCACTTCTTGCTG -3'
Posted On 2016-04-15