Incidental Mutation 'R4916:Urb1'
ID380123
Institutional Source Beutler Lab
Gene Symbol Urb1
Ensembl Gene ENSMUSG00000039929
Gene NameURB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms4921511H13Rik, 5730405K23Rik
MMRRC Submission 042518-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4916 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location90751527-90810413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90783328 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 649 (V649E)
Ref Sequence ENSEMBL: ENSMUSP00000114717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140920]
Predicted Effect probably damaging
Transcript: ENSMUST00000140920
AA Change: V649E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114717
Gene: ENSMUSG00000039929
AA Change: V649E

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:Npa1 78 396 1.5e-86 PFAM
low complexity region 751 761 N/A INTRINSIC
low complexity region 955 966 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
low complexity region 1360 1375 N/A INTRINSIC
Pfam:NopRA1 1670 1859 3.6e-60 PFAM
low complexity region 2029 2040 N/A INTRINSIC
low complexity region 2092 2111 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142955
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930595D18Rik G A 12: 111,174,935 Q19* probably null Het
5430419D17Rik T A 7: 131,174,477 probably null Het
6030468B19Rik T A 11: 117,806,266 C230* probably null Het
A730017C20Rik A T 18: 59,072,205 I22F probably damaging Het
Adcy10 A G 1: 165,518,246 E288G probably damaging Het
Adnp T A 2: 168,187,617 T51S possibly damaging Het
Agap3 C A 5: 24,478,013 A464D probably damaging Het
Ago4 A C 4: 126,506,842 C693G probably damaging Het
Ahi1 A G 10: 20,984,404 R675G probably damaging Het
Amigo1 T A 3: 108,187,665 L160Q probably damaging Het
Ankrd35 T C 3: 96,684,122 S575P probably benign Het
Ano3 T A 2: 110,771,020 T298S possibly damaging Het
Ap2b1 T G 11: 83,390,706 F813V probably damaging Het
Aplnr T G 2: 85,136,917 F95L probably damaging Het
Apobec2 T C 17: 48,423,125 E171G probably benign Het
Ascc1 A G 10: 60,004,862 N15S probably benign Het
AY358078 T A 14: 51,802,651 Y73N unknown Het
B3gnt8 C A 7: 25,628,883 P246Q probably damaging Het
C2cd2l T C 9: 44,316,560 Q250R probably damaging Het
Camk2d T C 3: 126,783,975 Y180H probably damaging Het
Ccdc129 C T 6: 55,978,190 P928S possibly damaging Het
Ccdc170 A G 10: 4,518,971 E167G probably damaging Het
Cdyl2 A G 8: 116,579,187 M445T probably damaging Het
Clca1 T C 3: 145,015,844 D322G probably benign Het
Cnot10 C T 9: 114,629,134 M101I possibly damaging Het
Cntrl C T 2: 35,165,682 T1196M probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcaf6 T C 1: 165,420,205 D153G probably damaging Het
Dennd2c G A 3: 103,131,824 G96E probably benign Het
Dhrs9 T C 2: 69,401,408 F304S probably damaging Het
Dmxl1 T C 18: 49,877,697 S974P probably damaging Het
Dnah6 T C 6: 73,192,676 probably benign Het
Dnah7c T C 1: 46,595,008 L1049P probably damaging Het
Dnajc2 T C 5: 21,757,340 K621E probably damaging Het
Ehbp1 T C 11: 22,146,592 D299G probably benign Het
Erap1 A G 13: 74,646,528 E102G probably benign Het
Fasn T G 11: 120,816,646 N799T probably benign Het
Fbxl20 T C 11: 98,128,360 D22G probably damaging Het
Fgfr1 T C 8: 25,563,526 probably null Het
Frzb A T 2: 80,446,527 I105N probably damaging Het
Gabrb1 T A 5: 71,869,421 F55Y probably damaging Het
Gatd1 G T 7: 141,409,097 C216* probably null Het
Gnl2 A C 4: 125,043,692 N255T probably damaging Het
Golgb1 A T 16: 36,916,118 Q1909L probably benign Het
Gpnmb T C 6: 49,051,970 L474P probably damaging Het
H60b T C 10: 22,287,216 V230A possibly damaging Het
Hmcn2 T A 2: 31,360,980 V818D probably damaging Het
Jade2 G T 11: 51,817,082 T768K probably benign Het
Kif28 T C 1: 179,702,520 H692R probably benign Het
Kmt2b T C 7: 30,578,517 N1634S probably damaging Het
Knop1 A G 7: 118,846,076 W222R probably damaging Het
Lrmp C A 6: 145,165,301 S277R probably damaging Het
Map1b T C 13: 99,433,300 D971G unknown Het
Mapk7 G T 11: 61,493,649 T77K probably damaging Het
Mcm6 A G 1: 128,348,977 L292P probably damaging Het
Megf8 T C 7: 25,339,664 L900P probably benign Het
Meis1 G A 11: 18,881,776 H421Y possibly damaging Het
Mllt1 T C 17: 56,899,813 T344A probably benign Het
Mta1 T A 12: 113,136,540 S657T probably benign Het
Mtus1 C A 8: 41,000,801 K998N probably damaging Het
Ncdn G A 4: 126,749,938 L364F possibly damaging Het
Ndufb7 T C 8: 83,570,905 L63P probably damaging Het
Nfix T C 8: 84,771,829 I172V probably benign Het
Nos1 T C 5: 117,947,570 probably null Het
Nrp1 C A 8: 128,502,804 S921* probably null Het
Olfr1459 T A 19: 13,145,991 I223L possibly damaging Het
Olfr401 A T 11: 74,121,879 I197F probably benign Het
Oma1 T C 4: 103,319,530 probably null Het
Pcp2 T A 8: 3,625,534 probably benign Het
Pdk4 T A 6: 5,489,157 H250L possibly damaging Het
Phldb3 A G 7: 24,624,291 H449R probably benign Het
Pip4k2c T C 10: 127,199,327 T391A possibly damaging Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Prkcg T G 7: 3,330,265 Y624* probably null Het
Psmg2 A G 18: 67,648,856 E164G probably damaging Het
Rb1 A T 14: 73,216,691 L589H probably damaging Het
Rcvrn A T 11: 67,695,765 I117F probably damaging Het
Rere T A 4: 150,619,144 W1528R probably damaging Het
Robo2 A G 16: 73,898,915 S1447P possibly damaging Het
Scfd2 C A 5: 74,462,658 G405W probably damaging Het
Scin T A 12: 40,069,374 I552F possibly damaging Het
Serpina3k G A 12: 104,343,010 V238M probably damaging Het
Slc1a6 G A 10: 78,796,251 V304M probably damaging Het
Slc20a2 C T 8: 22,561,004 S351L probably damaging Het
Slc31a2 T C 4: 62,297,088 V124A probably damaging Het
Slc38a3 T C 9: 107,656,227 N244S probably benign Het
Slc4a1 A G 11: 102,352,453 V784A probably damaging Het
Slc6a5 T C 7: 49,948,256 F623L probably benign Het
Slf2 T G 19: 44,971,661 D1022E probably damaging Het
Slfn8 G A 11: 83,016,878 H280Y probably damaging Het
Smpdl3a A T 10: 57,801,031 D45V probably damaging Het
Ssh3 T C 19: 4,265,142 E342G probably damaging Het
Tacr1 A T 6: 82,554,941 I273F probably benign Het
Tfg T A 16: 56,694,396 probably null Het
Tmem179 A G 12: 112,501,834 L71P probably damaging Het
Tmem63a T A 1: 180,966,521 I541N probably benign Het
Traj20 G A 14: 54,199,467 probably benign Het
Trappc13 A T 13: 104,154,294 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tulp1 A G 17: 28,359,135 L310P probably damaging Het
Ube2cbp A G 9: 86,422,872 Y306H probably damaging Het
Vps13d A G 4: 144,983,393 L4211P probably damaging Het
Vwa5b1 T A 4: 138,594,262 I407F possibly damaging Het
Vwce G T 19: 10,646,879 C378F probably damaging Het
Zfp791 T A 8: 85,110,951 I95L probably benign Het
Other mutations in Urb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Urb1 APN 16 90753321 critical splice donor site probably null
IGL00915:Urb1 APN 16 90779098 missense possibly damaging 0.76
IGL01108:Urb1 APN 16 90792814 missense probably damaging 1.00
IGL01122:Urb1 APN 16 90804458 missense possibly damaging 0.81
IGL01387:Urb1 APN 16 90757761 missense possibly damaging 0.64
IGL01484:Urb1 APN 16 90777560 missense probably benign 0.11
IGL01606:Urb1 APN 16 90760459 missense probably damaging 1.00
IGL01989:Urb1 APN 16 90769586 splice site probably benign
IGL02516:Urb1 APN 16 90772695 missense possibly damaging 0.49
IGL03018:Urb1 APN 16 90788156 missense probably benign 0.02
IGL03165:Urb1 APN 16 90780304 missense probably damaging 1.00
IGL03216:Urb1 APN 16 90788114 missense probably benign 0.00
H8562:Urb1 UTSW 16 90769469 missense probably benign 0.08
H8786:Urb1 UTSW 16 90769469 missense probably benign 0.08
R0064:Urb1 UTSW 16 90779140 missense probably benign
R0064:Urb1 UTSW 16 90779140 missense probably benign
R0359:Urb1 UTSW 16 90791160 missense probably damaging 1.00
R0386:Urb1 UTSW 16 90796399 missense probably damaging 1.00
R0508:Urb1 UTSW 16 90783262 splice site probably benign
R0517:Urb1 UTSW 16 90777422 nonsense probably null
R0704:Urb1 UTSW 16 90776207 missense probably benign 0.31
R0755:Urb1 UTSW 16 90774094 missense probably damaging 1.00
R0755:Urb1 UTSW 16 90779138 missense probably benign
R0783:Urb1 UTSW 16 90810297 missense possibly damaging 0.55
R0833:Urb1 UTSW 16 90795448 missense possibly damaging 0.89
R0836:Urb1 UTSW 16 90795448 missense possibly damaging 0.89
R0970:Urb1 UTSW 16 90769447 missense possibly damaging 0.83
R1144:Urb1 UTSW 16 90776318 splice site probably null
R1344:Urb1 UTSW 16 90769466 missense probably damaging 1.00
R1418:Urb1 UTSW 16 90769466 missense probably damaging 1.00
R1453:Urb1 UTSW 16 90796492 missense probably damaging 1.00
R1470:Urb1 UTSW 16 90752014 missense probably benign 0.34
R1470:Urb1 UTSW 16 90752014 missense probably benign 0.34
R1520:Urb1 UTSW 16 90774745 missense probably benign 0.00
R1521:Urb1 UTSW 16 90753863 missense probably damaging 1.00
R1598:Urb1 UTSW 16 90777440 missense possibly damaging 0.93
R1617:Urb1 UTSW 16 90760452 missense possibly damaging 0.82
R1625:Urb1 UTSW 16 90774048 critical splice donor site probably null
R1640:Urb1 UTSW 16 90772626 missense probably benign 0.00
R1664:Urb1 UTSW 16 90788082 critical splice donor site probably null
R1672:Urb1 UTSW 16 90787397 missense probably damaging 1.00
R1694:Urb1 UTSW 16 90767040 missense probably benign
R1856:Urb1 UTSW 16 90761695 missense probably benign 0.00
R2001:Urb1 UTSW 16 90762344 missense probably benign 0.30
R2196:Urb1 UTSW 16 90774256 missense probably benign 0.01
R2850:Urb1 UTSW 16 90774256 missense probably benign 0.01
R3009:Urb1 UTSW 16 90774798 missense probably benign 0.09
R3104:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3105:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3106:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3160:Urb1 UTSW 16 90797903 missense probably damaging 1.00
R3162:Urb1 UTSW 16 90797903 missense probably damaging 1.00
R3900:Urb1 UTSW 16 90783376 missense possibly damaging 0.86
R4014:Urb1 UTSW 16 90769465 missense probably damaging 1.00
R4036:Urb1 UTSW 16 90788086 missense probably benign
R4332:Urb1 UTSW 16 90774537 missense probably damaging 1.00
R4448:Urb1 UTSW 16 90769394 missense possibly damaging 0.71
R4581:Urb1 UTSW 16 90788146 missense probably benign 0.04
R4593:Urb1 UTSW 16 90787444 missense probably damaging 1.00
R4610:Urb1 UTSW 16 90776271 missense probably benign 0.43
R4659:Urb1 UTSW 16 90776129 missense probably damaging 0.96
R4672:Urb1 UTSW 16 90772634 missense probably benign
R4681:Urb1 UTSW 16 90804537 missense probably damaging 0.99
R4771:Urb1 UTSW 16 90753518 missense probably benign 0.00
R4790:Urb1 UTSW 16 90769555 nonsense probably null
R4798:Urb1 UTSW 16 90757827 missense probably benign 0.12
R4809:Urb1 UTSW 16 90759842 missense possibly damaging 0.82
R4850:Urb1 UTSW 16 90795414 nonsense probably null
R4969:Urb1 UTSW 16 90805411 missense probably damaging 1.00
R5032:Urb1 UTSW 16 90756171 missense probably benign 0.00
R5111:Urb1 UTSW 16 90752017 missense probably benign 0.00
R5122:Urb1 UTSW 16 90752095 nonsense probably null
R5184:Urb1 UTSW 16 90783274 critical splice donor site probably null
R5199:Urb1 UTSW 16 90792748 missense possibly damaging 0.95
R5436:Urb1 UTSW 16 90792762 missense probably damaging 1.00
R5767:Urb1 UTSW 16 90776163 missense probably benign 0.00
R5812:Urb1 UTSW 16 90804537 missense probably damaging 0.99
R5872:Urb1 UTSW 16 90772764 nonsense probably null
R6052:Urb1 UTSW 16 90762383 missense probably damaging 1.00
R6063:Urb1 UTSW 16 90789097 missense probably benign 0.02
R6065:Urb1 UTSW 16 90803332 missense probably benign 0.03
R6181:Urb1 UTSW 16 90779094 missense probably benign 0.00
R6268:Urb1 UTSW 16 90753919 missense probably benign 0.03
R6429:Urb1 UTSW 16 90762430 splice site probably null
R6572:Urb1 UTSW 16 90787414 missense probably benign 0.37
R6606:Urb1 UTSW 16 90810268 missense probably benign 0.00
R6730:Urb1 UTSW 16 90779083 missense possibly damaging 0.89
R6838:Urb1 UTSW 16 90782106 missense possibly damaging 0.93
R7237:Urb1 UTSW 16 90791166 missense probably damaging 1.00
R7238:Urb1 UTSW 16 90752115 missense possibly damaging 0.88
R7339:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7341:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7361:Urb1 UTSW 16 90774768 missense probably damaging 0.99
R7365:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7366:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7440:Urb1 UTSW 16 90787408 missense probably damaging 1.00
R7530:Urb1 UTSW 16 90761634 missense probably damaging 1.00
R7553:Urb1 UTSW 16 90792864 missense probably damaging 1.00
R7557:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7603:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7607:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7609:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7610:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7612:Urb1 UTSW 16 90797910 missense probably damaging 1.00
R7613:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7684:Urb1 UTSW 16 90786118 nonsense probably null
R8029:Urb1 UTSW 16 90779152 missense possibly damaging 0.67
Z1177:Urb1 UTSW 16 90753883 missense probably benign 0.00
Z1177:Urb1 UTSW 16 90774862 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGCTAGTCCTGACTGACTTTCATAG -3'
(R):5'- ATGATGAGCCTGGCAGTGTG -3'

Sequencing Primer
(F):5'- AGTCCTGACTGACTTTCATAGTTCAC -3'
(R):5'- GTAAGTACTGCCCCTTGT -3'
Posted On2016-04-15