Incidental Mutation 'R0244:Trps1'
ID38013
Institutional Source Beutler Lab
Gene Symbol Trps1
Ensembl Gene ENSMUSG00000038679
Gene Nametranscriptional repressor GATA binding 1
SynonymsD15Ertd586e
MMRRC Submission 038482-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0244 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location50654752-50890463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50664743 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 725 (N725D)
Ref Sequence ENSEMBL: ENSMUSP00000139115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077935] [ENSMUST00000165201] [ENSMUST00000183757] [ENSMUST00000183997] [ENSMUST00000184458] [ENSMUST00000184885]
Predicted Effect probably damaging
Transcript: ENSMUST00000077935
AA Change: N910D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077089
Gene: ENSMUSG00000038679
AA Change: N910D

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
ZnF_C2H2 333 358 4.45e0 SMART
ZnF_C2H2 434 459 1.31e2 SMART
ZnF_C2H2 523 554 1.93e2 SMART
low complexity region 597 602 N/A INTRINSIC
ZnF_C2H2 614 637 8.67e-1 SMART
ZnF_C2H2 666 689 2.29e0 SMART
ZnF_C2H2 692 715 8.22e-2 SMART
low complexity region 766 779 N/A INTRINSIC
ZnF_GATA 890 940 3.95e-16 SMART
low complexity region 1050 1062 N/A INTRINSIC
ZnF_C2H2 1215 1237 4.34e0 SMART
ZnF_C2H2 1243 1267 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165201
AA Change: N910D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129779
Gene: ENSMUSG00000038679
AA Change: N910D

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
ZnF_C2H2 333 358 4.45e0 SMART
ZnF_C2H2 434 459 1.31e2 SMART
ZnF_C2H2 523 554 1.93e2 SMART
low complexity region 597 602 N/A INTRINSIC
ZnF_C2H2 614 637 8.67e-1 SMART
ZnF_C2H2 666 689 2.29e0 SMART
ZnF_C2H2 692 715 8.22e-2 SMART
low complexity region 766 779 N/A INTRINSIC
ZnF_GATA 890 940 3.95e-16 SMART
low complexity region 1050 1062 N/A INTRINSIC
ZnF_C2H2 1215 1237 4.34e0 SMART
ZnF_C2H2 1243 1267 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183757
AA Change: N914D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139017
Gene: ENSMUSG00000038679
AA Change: N914D

DomainStartEndE-ValueType
ZnF_C2H2 226 251 1.41e0 SMART
ZnF_C2H2 337 362 4.45e0 SMART
ZnF_C2H2 438 463 1.31e2 SMART
ZnF_C2H2 527 558 1.93e2 SMART
low complexity region 601 606 N/A INTRINSIC
ZnF_C2H2 618 641 8.67e-1 SMART
ZnF_C2H2 670 693 2.29e0 SMART
ZnF_C2H2 696 719 8.22e-2 SMART
low complexity region 770 783 N/A INTRINSIC
ZnF_GATA 894 944 3.95e-16 SMART
low complexity region 1054 1066 N/A INTRINSIC
ZnF_C2H2 1219 1241 4.34e0 SMART
ZnF_C2H2 1247 1271 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183997
AA Change: N725D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139115
Gene: ENSMUSG00000038679
AA Change: N725D

DomainStartEndE-ValueType
ZnF_C2H2 226 251 1.41e0 SMART
ZnF_C2H2 337 362 4.45e0 SMART
ZnF_C2H2 470 493 2.29e0 SMART
ZnF_C2H2 496 519 8.22e-2 SMART
low complexity region 570 583 N/A INTRINSIC
ZnF_GATA 705 755 3.95e-16 SMART
low complexity region 865 877 N/A INTRINSIC
ZnF_C2H2 1030 1052 4.34e0 SMART
ZnF_C2H2 1058 1082 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184458
AA Change: N623D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139063
Gene: ENSMUSG00000038679
AA Change: N623D

DomainStartEndE-ValueType
ZnF_C2H2 46 71 4.45e0 SMART
ZnF_C2H2 147 172 1.31e2 SMART
ZnF_C2H2 236 267 1.93e2 SMART
low complexity region 310 315 N/A INTRINSIC
ZnF_C2H2 327 350 8.67e-1 SMART
ZnF_C2H2 379 402 2.29e0 SMART
ZnF_C2H2 405 428 8.22e-2 SMART
low complexity region 479 492 N/A INTRINSIC
ZnF_GATA 603 653 3.95e-16 SMART
low complexity region 763 775 N/A INTRINSIC
ZnF_C2H2 928 950 4.34e0 SMART
ZnF_C2H2 956 980 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184885
AA Change: N664D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138905
Gene: ENSMUSG00000038679
AA Change: N664D

DomainStartEndE-ValueType
ZnF_C2H2 176 201 1.41e0 SMART
ZnF_C2H2 287 312 4.45e0 SMART
ZnF_C2H2 420 443 2.29e0 SMART
ZnF_C2H2 446 469 8.22e-2 SMART
low complexity region 520 533 N/A INTRINSIC
ZnF_GATA 644 694 3.95e-16 SMART
low complexity region 804 816 N/A INTRINSIC
ZnF_C2H2 969 991 4.34e0 SMART
ZnF_C2H2 997 1021 5.72e-1 SMART
Meta Mutation Damage Score 0.5617 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that represses GATA-regulated genes and binds to a dynein light chain protein. Binding of the encoded protein to the dynein light chain protein affects binding to GATA consensus sequences and suppresses its transcriptional activity. Defects in this gene are a cause of tricho-rhino-phalangeal syndrome (TRPS) types I-III. [provided by RefSeq, Jul 2008]
PHENOTYPE: Newborn mice homozygous for a knock-out allele exhibit craniofacial and hair anomalies and die of respiratory failure due to thoracic spine and rib defects. Mice homozygous for a reporter allele show additional defects in chondrocyte proliferation and apoptosis as well as reduced nephron formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,286,491 probably null Het
Adamdec1 A T 14: 68,568,723 C434* probably null Het
Adprhl1 A G 8: 13,242,391 probably benign Het
Ago1 T A 4: 126,463,706 I59F possibly damaging Het
Arel1 T C 12: 84,920,693 T786A probably damaging Het
Arhgap26 A G 18: 39,363,131 K117R probably benign Het
Atp6v0b C T 4: 117,884,622 G204D probably damaging Het
Bace2 T A 16: 97,436,773 probably null Het
Camk4 G A 18: 33,179,625 probably null Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cep152 T C 2: 125,564,214 E1466G probably benign Het
Ces3b T C 8: 105,092,635 F441S probably damaging Het
Cfap52 T C 11: 67,926,382 T562A possibly damaging Het
Clca3a2 C A 3: 144,813,898 M238I possibly damaging Het
Cntnap5c A T 17: 58,102,168 D467V probably damaging Het
Col7a1 T A 9: 108,972,184 probably null Het
Cstf1 A G 2: 172,377,710 N247S possibly damaging Het
Dffb G T 4: 153,974,615 N68K probably benign Het
Duox2 C T 2: 122,291,860 G595S probably benign Het
Eftud2 T A 11: 102,864,725 I228F probably damaging Het
Elmo3 T C 8: 105,309,171 V578A probably benign Het
Elp2 A G 18: 24,631,471 D625G possibly damaging Het
Ep300 C T 15: 81,640,128 P1386S unknown Het
Fam120b A G 17: 15,417,637 D610G probably damaging Het
Fastk A T 5: 24,442,178 probably benign Het
Fbxl6 A G 15: 76,537,191 S252P probably damaging Het
Fbxo43 T C 15: 36,161,793 K423E probably damaging Het
Filip1 T A 9: 79,819,462 E625V possibly damaging Het
Fkbp9 T A 6: 56,856,378 Y283* probably null Het
Gigyf2 T A 1: 87,379,015 D142E possibly damaging Het
Gm10142 T C 10: 77,716,014 probably null Het
Golga5 T C 12: 102,476,188 V262A probably benign Het
Hectd4 T C 5: 121,329,605 V2539A probably benign Het
Ica1 G T 6: 8,653,632 S335* probably null Het
Itga1 A T 13: 115,006,897 probably benign Het
Itgb1 T C 8: 128,717,685 probably benign Het
Itpr1 G A 6: 108,473,589 V1960I probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kprp C T 3: 92,825,411 V111I probably benign Het
Lamc3 T C 2: 31,940,721 I1490T probably damaging Het
Lcp1 A T 14: 75,227,001 D554V possibly damaging Het
Lgi3 A G 14: 70,534,698 T228A probably benign Het
Lipa A T 19: 34,501,541 F260I probably damaging Het
Lrriq1 C T 10: 103,215,773 E373K probably damaging Het
Map6 G A 7: 99,336,836 G649D probably benign Het
Mccc1 A G 3: 35,990,047 probably null Het
Mical3 A T 6: 120,957,722 S1799T probably benign Het
Mmp23 T A 4: 155,652,132 T151S probably damaging Het
Myo1d T A 11: 80,674,708 N401I probably damaging Het
Myo9b T A 8: 71,321,813 S323T probably damaging Het
Nbn G T 4: 15,979,353 W446L probably benign Het
Nedd1 A T 10: 92,716,265 probably benign Het
Ngef C A 1: 87,487,962 probably benign Het
Nup153 A T 13: 46,693,936 N672K probably benign Het
Olfr1308 T C 2: 111,961,016 N19S probably benign Het
Olfr149 T A 9: 39,702,173 I199F probably damaging Het
Olfr1509 T C 14: 52,450,512 V33A probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Palm2 T G 4: 57,710,177 V374G possibly damaging Het
Pdlim3 C A 8: 45,908,460 probably benign Het
Pmfbp1 G A 8: 109,541,673 E951K probably damaging Het
Pop1 T A 15: 34,515,891 C548* probably null Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Ptpdc1 A T 13: 48,585,980 N658K probably benign Het
Ptprk A C 10: 28,206,225 E63D possibly damaging Het
Rtf1 C T 2: 119,732,877 R712W probably damaging Het
Samd7 A C 3: 30,751,073 T2P probably benign Het
Sft2d1 A G 17: 8,319,422 T52A probably benign Het
Slc25a26 A G 6: 94,510,833 H91R probably damaging Het
Slc5a4a A G 10: 76,189,152 E621G possibly damaging Het
Slf1 A T 13: 77,126,632 L28* probably null Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Sorcs2 G A 5: 36,397,553 probably benign Het
Tacc2 T C 7: 130,751,825 probably benign Het
Tas2r140 A G 6: 133,055,327 V156A possibly damaging Het
Terf2ip C A 8: 112,018,164 T371K possibly damaging Het
Tifa C T 3: 127,796,888 L103F probably damaging Het
Tmco3 A G 8: 13,292,037 N104D probably damaging Het
Tmem259 T A 10: 79,978,963 D240V probably damaging Het
Trim60 C T 8: 65,001,048 R183H probably benign Het
Ttn C T 2: 76,814,806 V12902M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Unc79 A G 12: 103,112,891 K1772E probably damaging Het
Vwde C T 6: 13,193,126 V405I probably benign Het
Wdr18 T A 10: 79,966,408 D290E probably damaging Het
Wdr92 T C 11: 17,229,851 L284P probably damaging Het
Wwc2 G A 8: 47,900,721 A126V probably benign Het
Zfp882 A T 8: 71,913,523 I105F possibly damaging Het
Zfp942 A T 17: 21,928,572 C359S probably benign Het
Other mutations in Trps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Trps1 APN 15 50846870 missense probably benign 0.07
IGL00497:Trps1 APN 15 50661307 missense possibly damaging 0.91
IGL00558:Trps1 APN 15 50661085 missense probably damaging 1.00
IGL01325:Trps1 APN 15 50846814 missense probably benign 0.40
IGL02132:Trps1 APN 15 50822278 missense probably damaging 1.00
IGL02631:Trps1 APN 15 50846021 missense probably damaging 1.00
IGL02740:Trps1 APN 15 50846539 missense probably damaging 1.00
IGL02821:Trps1 APN 15 50660877 missense probably damaging 1.00
IGL03096:Trps1 APN 15 50846479 missense probably benign
F5770:Trps1 UTSW 15 50831577 missense probably damaging 1.00
R0050:Trps1 UTSW 15 50765525 missense probably benign 0.18
R0377:Trps1 UTSW 15 50831778 nonsense probably null
R0599:Trps1 UTSW 15 50831860 nonsense probably null
R0848:Trps1 UTSW 15 50661549 missense possibly damaging 0.54
R1744:Trps1 UTSW 15 50661213 missense probably damaging 1.00
R1830:Trps1 UTSW 15 50661136 missense probably damaging 0.99
R2083:Trps1 UTSW 15 50822305 missense probably damaging 1.00
R2167:Trps1 UTSW 15 50831730 missense possibly damaging 0.94
R2267:Trps1 UTSW 15 50822398 missense probably damaging 1.00
R2314:Trps1 UTSW 15 50661346 missense probably damaging 1.00
R3735:Trps1 UTSW 15 50846060 missense possibly damaging 0.94
R4133:Trps1 UTSW 15 50831387 missense probably damaging 1.00
R4223:Trps1 UTSW 15 50846648 missense probably benign
R4280:Trps1 UTSW 15 50846082 missense probably benign 0.00
R4566:Trps1 UTSW 15 50831678 missense probably damaging 1.00
R4810:Trps1 UTSW 15 50822296 missense probably benign 0.14
R4828:Trps1 UTSW 15 50660677 makesense probably null
R4838:Trps1 UTSW 15 50827316 missense probably benign 0.05
R4852:Trps1 UTSW 15 50846309 missense probably damaging 1.00
R5001:Trps1 UTSW 15 50661307 missense possibly damaging 0.91
R5311:Trps1 UTSW 15 50664760 missense probably damaging 1.00
R5463:Trps1 UTSW 15 50831890 nonsense probably null
R5677:Trps1 UTSW 15 50846108 missense probably damaging 1.00
R5691:Trps1 UTSW 15 50827304 missense probably benign
R6432:Trps1 UTSW 15 50831397 missense probably damaging 0.96
R6528:Trps1 UTSW 15 50822427 missense probably benign 0.01
R6594:Trps1 UTSW 15 50830955 missense probably damaging 0.99
R6827:Trps1 UTSW 15 50822563 missense probably benign 0.14
R6862:Trps1 UTSW 15 50831605 critical splice donor site probably null
R6912:Trps1 UTSW 15 50822298 missense possibly damaging 0.92
R7151:Trps1 UTSW 15 50822397 missense possibly damaging 0.95
R7846:Trps1 UTSW 15 50831877 missense probably damaging 0.99
R7857:Trps1 UTSW 15 50661005 missense probably damaging 1.00
R7929:Trps1 UTSW 15 50831877 missense probably damaging 0.99
R7940:Trps1 UTSW 15 50661005 missense probably damaging 1.00
V7580:Trps1 UTSW 15 50831577 missense probably damaging 1.00
V7581:Trps1 UTSW 15 50831577 missense probably damaging 1.00
V7583:Trps1 UTSW 15 50831577 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAATGGGAACATTCAGGGTGCTTC -3'
(R):5'- CCTGACCTCATTATGGGCAGTGTG -3'

Sequencing Primer
(F):5'- CAGCCAATTCAGTTAACAGGTAG -3'
(R):5'- ATACTGTCATTGTTGGGAGTCTAAAG -3'
Posted On2013-05-23