Incidental Mutation 'R4860:Rprd1b'
ID380145
Institutional Source Beutler Lab
Gene Symbol Rprd1b
Ensembl Gene ENSMUSG00000027651
Gene Nameregulation of nuclear pre-mRNA domain containing 1B
Synonyms2610304G08Rik, Crept, 2810446G03Rik
MMRRC Submission 042471-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R4860 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location158028497-158132297 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 158074935 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 278 (Y278*)
Ref Sequence ENSEMBL: ENSMUSP00000099412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029180] [ENSMUST00000103123] [ENSMUST00000109518] [ENSMUST00000152452]
Predicted Effect probably null
Transcript: ENSMUST00000029180
AA Change: Y279*
SMART Domains Protein: ENSMUSP00000029180
Gene: ENSMUSG00000027651
AA Change: Y279*

DomainStartEndE-ValueType
RPR 8 130 1.71e-53 SMART
low complexity region 132 145 N/A INTRINSIC
Pfam:CREPT 178 324 1.7e-65 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000103123
AA Change: Y278*
SMART Domains Protein: ENSMUSP00000099412
Gene: ENSMUSG00000027651
AA Change: Y278*

DomainStartEndE-ValueType
RPR 8 130 1.71e-53 SMART
PDB:4NAD|A 176 325 1e-85 PDB
Blast:RPR 219 260 3e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109518
SMART Domains Protein: ENSMUSP00000105144
Gene: ENSMUSG00000027651

DomainStartEndE-ValueType
RPR 8 130 1.71e-53 SMART
low complexity region 132 145 N/A INTRINSIC
PDB:4FLA|D 171 265 4e-59 PDB
Blast:RPR 220 261 2e-12 BLAST
low complexity region 266 279 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128206
SMART Domains Protein: ENSMUSP00000117807
Gene: ENSMUSG00000027651

DomainStartEndE-ValueType
Blast:RPR 2 30 4e-12 BLAST
PDB:4HFG|B 2 30 4e-13 PDB
low complexity region 31 47 N/A INTRINSIC
Pfam:CREPT 78 192 5.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135603
SMART Domains Protein: ENSMUSP00000122419
Gene: ENSMUSG00000027651

DomainStartEndE-ValueType
Pfam:CREPT 26 131 2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152452
SMART Domains Protein: ENSMUSP00000118434
Gene: ENSMUSG00000027651

DomainStartEndE-ValueType
RPR 8 130 1.71e-53 SMART
low complexity region 132 145 N/A INTRINSIC
PDB:4FLA|D 171 222 3e-25 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186977
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 94% (98/104)
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,455,423 S466P possibly damaging Het
1700061G19Rik A G 17: 56,888,655 N684S probably benign Het
4930435E12Rik A G 16: 38,828,145 S201P probably damaging Het
Ablim1 T C 19: 57,079,866 T267A probably damaging Het
Acap2 A T 16: 31,103,499 L724Q possibly damaging Het
Adcy4 T C 14: 55,781,927 T89A possibly damaging Het
Agrp T C 8: 105,567,368 E41G probably benign Het
Akap9 G A 5: 4,034,916 probably benign Het
Akr1d1 G A 6: 37,564,491 V308M probably damaging Het
Ap1m2 C T 9: 21,309,674 R54Q probably benign Het
Arhgap45 T A 10: 80,027,066 V692E probably damaging Het
Arid5b G T 10: 68,243,095 N137K probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
BC048679 T C 7: 81,495,720 N27D probably benign Het
Ccdc78 A G 17: 25,788,700 N237S probably benign Het
Cd46 G A 1: 195,062,396 L345F possibly damaging Het
Cngb3 A T 4: 19,425,569 N459I possibly damaging Het
Ctnnd2 A G 15: 30,881,167 E731G probably damaging Het
Cul1 G T 6: 47,517,146 K464N probably benign Het
Cul1 T A 6: 47,517,191 S479R probably damaging Het
Dcaf5 A T 12: 80,340,232 D373E probably benign Het
Ddx58 G T 4: 40,210,000 S644R probably damaging Het
Dhcr7 A G 7: 143,840,500 Q126R probably benign Het
Dnd1 C T 18: 36,765,963 probably benign Het
Dok2 T C 14: 70,777,516 F228L probably damaging Het
Dpep3 T G 8: 105,976,189 I314L probably benign Het
Eps8 A G 6: 137,514,295 F362L probably damaging Het
Espn G T 4: 152,138,846 R250S probably damaging Het
Faf1 A C 4: 109,742,896 N163H probably damaging Het
Fam198b C A 3: 79,936,674 S36* probably null Het
Fam71e2 C T 7: 4,757,469 probably null Het
Fcho1 C T 8: 71,710,481 V635I probably benign Het
Gm7579 G A 7: 142,211,908 C17Y unknown Het
Gm996 T C 2: 25,578,753 Y382C probably damaging Het
Gpx8 G T 13: 113,045,508 Y130* probably null Het
Grm6 C T 11: 50,864,612 T857M probably benign Het
Gvin1 A T 7: 106,163,436 Y609N possibly damaging Het
Hectd4 T A 5: 121,305,818 M30K probably benign Het
Ilkap A G 1: 91,387,383 probably benign Het
Iqub T C 6: 24,450,842 D586G probably damaging Het
Klhl22 G A 16: 17,777,016 silent Het
Klhl25 T C 7: 75,867,050 I568T probably benign Het
Krr1 C T 10: 111,985,691 probably benign Het
Larp6 A G 9: 60,737,810 E411G probably damaging Het
Lepr A C 4: 101,789,337 I822L probably benign Het
Lrig3 C A 10: 126,011,052 D896E probably benign Het
Lrp1 C T 10: 127,553,824 G3114D probably damaging Het
Macf1 A T 4: 123,486,750 Y1263N probably damaging Het
Mapk10 T C 5: 102,990,619 D180G probably damaging Het
Matr3 T A 18: 35,581,640 V113E probably damaging Het
Mbd4 A T 6: 115,848,926 F368Y possibly damaging Het
Mcpt8 G A 14: 56,082,280 R238W probably benign Het
Mcrip2 G T 17: 25,864,647 T86N possibly damaging Het
Mink1 A G 11: 70,611,592 N1043S probably damaging Het
Nbeal2 G A 9: 110,635,194 T1128I probably benign Het
Nrg2 T A 18: 36,196,547 Y205F probably damaging Het
Nsmce4a A T 7: 130,533,591 probably benign Het
Nubp2 A G 17: 24,884,456 M149T probably benign Het
Olfr1062 T C 2: 86,422,957 T240A probably damaging Het
Olfr462 T A 11: 87,889,225 M224L probably damaging Het
Olfr974 G T 9: 39,942,504 M81I probably benign Het
Pax3 A G 1: 78,192,456 I191T possibly damaging Het
Pdcd5 T C 7: 35,643,710 N137D possibly damaging Het
Pik3c2a G A 7: 116,340,156 A1649V probably damaging Het
Pik3r6 T A 11: 68,544,053 probably benign Het
Pkhd1l1 T C 15: 44,537,378 S2183P possibly damaging Het
Plekho1 T A 3: 95,988,993 Q388L possibly damaging Het
Ppfibp1 A G 6: 146,990,514 T91A probably benign Het
Ptger4 G T 15: 5,242,606 N177K probably benign Het
Reln A G 5: 21,901,751 F3207S probably benign Het
Ripk4 C T 16: 97,751,536 R194H probably damaging Het
Rnf112 A T 11: 61,452,744 C112S possibly damaging Het
Sel1l A G 12: 91,831,602 L140P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc38a3 A G 9: 107,655,064 V423A probably damaging Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Slmap A T 14: 26,460,209 V323E probably benign Het
Smim6 T C 11: 115,913,504 V39A probably benign Het
Snapc3 C T 4: 83,464,897 probably benign Het
Sorbs1 T C 19: 40,337,005 T382A probably benign Het
Sparc G A 11: 55,399,211 T218I possibly damaging Het
Steap1 A T 5: 5,736,589 F283I probably damaging Het
Stil A G 4: 115,038,474 T586A probably benign Het
Tango2 A G 16: 18,310,901 silent Het
Tbce T A 13: 14,019,795 D93V probably damaging Het
Tcf12 C T 9: 71,858,840 G504S probably null Het
Tle4 A T 19: 14,464,345 I435K probably benign Het
Tmem245 A G 4: 56,899,164 F254S probably damaging Het
Tmem251 A T 12: 102,744,055 probably benign Het
Tubgcp3 T C 8: 12,649,722 K377R probably benign Het
Ulk4 G A 9: 121,250,902 T497M possibly damaging Het
Ush2a A T 1: 188,553,275 T2003S probably benign Het
Usp53 A G 3: 122,961,363 S32P possibly damaging Het
Vmn1r78 T A 7: 12,152,756 L98Q probably damaging Het
Vmn2r84 T A 10: 130,385,843 D836V probably damaging Het
Vps13d A G 4: 145,087,161 F165L probably benign Het
Vstm4 A G 14: 32,863,785 E103G possibly damaging Het
Zfp384 G A 6: 125,030,930 silent Het
Zfp870 A T 17: 32,883,340 C339* probably null Het
Other mutations in Rprd1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01682:Rprd1b APN 2 158050160 missense probably damaging 1.00
IGL02740:Rprd1b APN 2 158047979 missense probably damaging 0.99
IGL03335:Rprd1b APN 2 158074964 missense probably damaging 1.00
Rarefied UTSW 2 158058736 missense probably damaging 1.00
PIT4585001:Rprd1b UTSW 2 158047957 missense probably benign 0.00
R4761:Rprd1b UTSW 2 158047970 missense probably damaging 0.96
R4860:Rprd1b UTSW 2 158074935 nonsense probably null
R5352:Rprd1b UTSW 2 158058736 missense probably damaging 1.00
R5409:Rprd1b UTSW 2 158075067 missense probably damaging 1.00
R7251:Rprd1b UTSW 2 158028979 missense probably damaging 1.00
X0028:Rprd1b UTSW 2 158047970 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATCCGTCAGCTGCTGTGTTC -3'
(R):5'- AACCTGGGGCATGATACCTG -3'

Sequencing Primer
(F):5'- GCTCTCAGCATTATGGCAAACTC -3'
(R):5'- GGCATGATACCTGTCCTAGTCAG -3'
Posted On2016-04-15