Incidental Mutation 'R4860:Stil'
ID380155
Institutional Source Beutler Lab
Gene Symbol Stil
Ensembl Gene ENSMUSG00000028718
Gene NameScl/Tal1 interrupting locus
SynonymsSil
MMRRC Submission 042471-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4860 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location115000159-115043196 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115038474 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 586 (T586A)
Ref Sequence ENSEMBL: ENSMUSP00000123385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030490] [ENSMUST00000129957] [ENSMUST00000141933]
Predicted Effect probably benign
Transcript: ENSMUST00000030490
AA Change: T898A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000030490
Gene: ENSMUSG00000028718
AA Change: T898A

DomainStartEndE-ValueType
Pfam:STIL_N 22 426 5.1e-199 PFAM
low complexity region 709 724 N/A INTRINSIC
low complexity region 1106 1118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129957
AA Change: T586A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000123385
Gene: ENSMUSG00000028718
AA Change: T586A

DomainStartEndE-ValueType
Pfam:STIL_N 22 416 1.5e-180 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141933
SMART Domains Protein: ENSMUSP00000118849
Gene: ENSMUSG00000028718

DomainStartEndE-ValueType
Pfam:STIL_N 22 392 6.6e-166 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 94% (98/104)
MGI Phenotype FUNCTION: This gene encodes a centrosomal protein ubiquitously expressed in proliferating cells and during early embryonic development. Mice lacking the encoded protein die in utero with marked growth retardation, defects in the developing neural fold and randomization of left-right asymmetry. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos with various neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,455,423 S466P possibly damaging Het
1700061G19Rik A G 17: 56,888,655 N684S probably benign Het
4930435E12Rik A G 16: 38,828,145 S201P probably damaging Het
Ablim1 T C 19: 57,079,866 T267A probably damaging Het
Acap2 A T 16: 31,103,499 L724Q possibly damaging Het
Adcy4 T C 14: 55,781,927 T89A possibly damaging Het
Agrp T C 8: 105,567,368 E41G probably benign Het
Akap9 G A 5: 4,034,916 probably benign Het
Akr1d1 G A 6: 37,564,491 V308M probably damaging Het
Ap1m2 C T 9: 21,309,674 R54Q probably benign Het
Arhgap45 T A 10: 80,027,066 V692E probably damaging Het
Arid5b G T 10: 68,243,095 N137K probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
BC048679 T C 7: 81,495,720 N27D probably benign Het
Ccdc78 A G 17: 25,788,700 N237S probably benign Het
Cd46 G A 1: 195,062,396 L345F possibly damaging Het
Cngb3 A T 4: 19,425,569 N459I possibly damaging Het
Ctnnd2 A G 15: 30,881,167 E731G probably damaging Het
Cul1 G T 6: 47,517,146 K464N probably benign Het
Cul1 T A 6: 47,517,191 S479R probably damaging Het
Dcaf5 A T 12: 80,340,232 D373E probably benign Het
Ddx58 G T 4: 40,210,000 S644R probably damaging Het
Dhcr7 A G 7: 143,840,500 Q126R probably benign Het
Dnd1 C T 18: 36,765,963 probably benign Het
Dok2 T C 14: 70,777,516 F228L probably damaging Het
Dpep3 T G 8: 105,976,189 I314L probably benign Het
Eps8 A G 6: 137,514,295 F362L probably damaging Het
Espn G T 4: 152,138,846 R250S probably damaging Het
Faf1 A C 4: 109,742,896 N163H probably damaging Het
Fam198b C A 3: 79,936,674 S36* probably null Het
Fam71e2 C T 7: 4,757,469 probably null Het
Fcho1 C T 8: 71,710,481 V635I probably benign Het
Gm7579 G A 7: 142,211,908 C17Y unknown Het
Gm996 T C 2: 25,578,753 Y382C probably damaging Het
Gpx8 G T 13: 113,045,508 Y130* probably null Het
Grm6 C T 11: 50,864,612 T857M probably benign Het
Gvin1 A T 7: 106,163,436 Y609N possibly damaging Het
Hectd4 T A 5: 121,305,818 M30K probably benign Het
Ilkap A G 1: 91,387,383 probably benign Het
Iqub T C 6: 24,450,842 D586G probably damaging Het
Klhl22 G A 16: 17,777,016 silent Het
Klhl25 T C 7: 75,867,050 I568T probably benign Het
Krr1 C T 10: 111,985,691 probably benign Het
Larp6 A G 9: 60,737,810 E411G probably damaging Het
Lepr A C 4: 101,789,337 I822L probably benign Het
Lrig3 C A 10: 126,011,052 D896E probably benign Het
Lrp1 C T 10: 127,553,824 G3114D probably damaging Het
Macf1 A T 4: 123,486,750 Y1263N probably damaging Het
Mapk10 T C 5: 102,990,619 D180G probably damaging Het
Matr3 T A 18: 35,581,640 V113E probably damaging Het
Mbd4 A T 6: 115,848,926 F368Y possibly damaging Het
Mcpt8 G A 14: 56,082,280 R238W probably benign Het
Mcrip2 G T 17: 25,864,647 T86N possibly damaging Het
Mink1 A G 11: 70,611,592 N1043S probably damaging Het
Nbeal2 G A 9: 110,635,194 T1128I probably benign Het
Nrg2 T A 18: 36,196,547 Y205F probably damaging Het
Nsmce4a A T 7: 130,533,591 probably benign Het
Nubp2 A G 17: 24,884,456 M149T probably benign Het
Olfr1062 T C 2: 86,422,957 T240A probably damaging Het
Olfr462 T A 11: 87,889,225 M224L probably damaging Het
Olfr974 G T 9: 39,942,504 M81I probably benign Het
Pax3 A G 1: 78,192,456 I191T possibly damaging Het
Pdcd5 T C 7: 35,643,710 N137D possibly damaging Het
Pik3c2a G A 7: 116,340,156 A1649V probably damaging Het
Pik3r6 T A 11: 68,544,053 probably benign Het
Pkhd1l1 T C 15: 44,537,378 S2183P possibly damaging Het
Plekho1 T A 3: 95,988,993 Q388L possibly damaging Het
Ppfibp1 A G 6: 146,990,514 T91A probably benign Het
Ptger4 G T 15: 5,242,606 N177K probably benign Het
Reln A G 5: 21,901,751 F3207S probably benign Het
Ripk4 C T 16: 97,751,536 R194H probably damaging Het
Rnf112 A T 11: 61,452,744 C112S possibly damaging Het
Rprd1b T G 2: 158,074,935 Y278* probably null Het
Sel1l A G 12: 91,831,602 L140P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc38a3 A G 9: 107,655,064 V423A probably damaging Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Slmap A T 14: 26,460,209 V323E probably benign Het
Smim6 T C 11: 115,913,504 V39A probably benign Het
Snapc3 C T 4: 83,464,897 probably benign Het
Sorbs1 T C 19: 40,337,005 T382A probably benign Het
Sparc G A 11: 55,399,211 T218I possibly damaging Het
Steap1 A T 5: 5,736,589 F283I probably damaging Het
Tango2 A G 16: 18,310,901 silent Het
Tbce T A 13: 14,019,795 D93V probably damaging Het
Tcf12 C T 9: 71,858,840 G504S probably null Het
Tle4 A T 19: 14,464,345 I435K probably benign Het
Tmem245 A G 4: 56,899,164 F254S probably damaging Het
Tmem251 A T 12: 102,744,055 probably benign Het
Tubgcp3 T C 8: 12,649,722 K377R probably benign Het
Ulk4 G A 9: 121,250,902 T497M possibly damaging Het
Ush2a A T 1: 188,553,275 T2003S probably benign Het
Usp53 A G 3: 122,961,363 S32P possibly damaging Het
Vmn1r78 T A 7: 12,152,756 L98Q probably damaging Het
Vmn2r84 T A 10: 130,385,843 D836V probably damaging Het
Vps13d A G 4: 145,087,161 F165L probably benign Het
Vstm4 A G 14: 32,863,785 E103G possibly damaging Het
Zfp384 G A 6: 125,030,930 silent Het
Zfp870 A T 17: 32,883,340 C339* probably null Het
Other mutations in Stil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Stil APN 4 115024112 missense probably benign 0.29
IGL01672:Stil APN 4 115032789 missense probably damaging 1.00
IGL02058:Stil APN 4 115014162 missense probably benign 0.00
IGL02076:Stil APN 4 115023637 missense probably benign 0.03
IGL02104:Stil APN 4 115041482 missense probably damaging 1.00
IGL02355:Stil APN 4 115010111 missense probably damaging 1.00
IGL02362:Stil APN 4 115010111 missense probably damaging 1.00
IGL02612:Stil APN 4 115023696 missense possibly damaging 0.80
IGL02695:Stil APN 4 115016175 missense probably damaging 1.00
IGL02696:Stil APN 4 115041495 missense probably damaging 0.99
IGL02826:Stil APN 4 115024098 missense probably benign 0.01
IGL02946:Stil APN 4 115029913 missense probably benign 0.05
IGL03146:Stil APN 4 115024415 missense probably damaging 1.00
R0058:Stil UTSW 4 115041298 missense probably damaging 1.00
R0256:Stil UTSW 4 115023685 missense possibly damaging 0.80
R0324:Stil UTSW 4 115039149 missense probably benign 0.01
R0391:Stil UTSW 4 115041172 critical splice acceptor site probably null
R0602:Stil UTSW 4 115024423 splice site probably benign
R0620:Stil UTSW 4 115007159 missense possibly damaging 0.52
R1452:Stil UTSW 4 115039195 missense probably benign 0.00
R1462:Stil UTSW 4 115023964 missense probably benign 0.00
R1462:Stil UTSW 4 115023964 missense probably benign 0.00
R1544:Stil UTSW 4 115023852 missense probably damaging 0.97
R1789:Stil UTSW 4 115041782 missense probably benign 0.01
R1878:Stil UTSW 4 115041226 missense probably damaging 1.00
R1895:Stil UTSW 4 115023875 missense probably benign 0.40
R2325:Stil UTSW 4 115032707 missense probably benign 0.12
R2401:Stil UTSW 4 115016286 missense probably null 0.81
R3054:Stil UTSW 4 115004966 missense probably damaging 1.00
R3055:Stil UTSW 4 115014069 splice site probably benign
R4097:Stil UTSW 4 115023600 missense probably benign 0.04
R4330:Stil UTSW 4 115004979 missense probably damaging 1.00
R4418:Stil UTSW 4 115009377 missense probably benign 0.17
R4665:Stil UTSW 4 115041644 missense probably benign 0.00
R4688:Stil UTSW 4 115041308 missense probably damaging 1.00
R4740:Stil UTSW 4 115006782 missense probably benign 0.15
R4860:Stil UTSW 4 115038474 missense probably benign 0.01
R4909:Stil UTSW 4 115024225 nonsense probably null
R6130:Stil UTSW 4 115029861 splice site probably null
R6523:Stil UTSW 4 115032714 frame shift probably null
R7294:Stil UTSW 4 115007283 missense probably benign 0.17
R7357:Stil UTSW 4 115014226 critical splice donor site probably null
R7387:Stil UTSW 4 115024036 missense probably benign 0.37
R7592:Stil UTSW 4 115023808 missense probably benign 0.00
R7776:Stil UTSW 4 115032838 missense possibly damaging 0.49
Z1088:Stil UTSW 4 115006693 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCTGTTGACCCTGCGTG -3'
(R):5'- TTTAGGAAACTGTCACAAGGAAGGC -3'

Sequencing Primer
(F):5'- CGTGTCCTTTGCAGCAGC -3'
(R):5'- TGTCACAAGGAAGGCTAAATATTATC -3'
Posted On2016-04-15