Incidental Mutation 'R4860:Espn'
ID380158
Institutional Source Beutler Lab
Gene Symbol Espn
Ensembl Gene ENSMUSG00000028943
Gene Nameespin
Synonyms
MMRRC Submission 042471-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R4860 (G1)
Quality Score118
Status Validated
Chromosome4
Chromosomal Location152120331-152152371 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 152138846 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 250 (R250S)
Ref Sequence ENSEMBL: ENSMUSP00000101284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030785] [ENSMUST00000070018] [ENSMUST00000080042] [ENSMUST00000084114] [ENSMUST00000103196] [ENSMUST00000105654] [ENSMUST00000105655] [ENSMUST00000105656] [ENSMUST00000105657] [ENSMUST00000105658] [ENSMUST00000105659] [ENSMUST00000135185] [ENSMUST00000207676]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030785
AA Change: R250S

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000030785
Gene: ENSMUSG00000028943
AA Change: R250S

DomainStartEndE-ValueType
ANK 35 64 3.26e0 SMART
ANK 69 99 1.15e0 SMART
ANK 103 133 2.58e-3 SMART
ANK 137 167 1.63e0 SMART
ANK 171 201 4.97e-5 SMART
ANK 205 235 3.08e-1 SMART
ANK 239 268 9.13e-4 SMART
ANK 271 300 2.15e0 SMART
ANK 304 334 2.08e3 SMART
low complexity region 377 395 N/A INTRINSIC
low complexity region 428 465 N/A INTRINSIC
low complexity region 605 629 N/A INTRINSIC
WH2 669 686 4.82e-3 SMART
low complexity region 714 728 N/A INTRINSIC
low complexity region 740 748 N/A INTRINSIC
coiled coil region 772 848 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070018
SMART Domains Protein: ENSMUSP00000065545
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 101 138 N/A INTRINSIC
low complexity region 267 291 N/A INTRINSIC
low complexity region 304 313 N/A INTRINSIC
WH2 322 339 4.82e-3 SMART
low complexity region 367 381 N/A INTRINSIC
low complexity region 393 401 N/A INTRINSIC
SCOP:d1eq1a_ 432 499 4e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080042
SMART Domains Protein: ENSMUSP00000078951
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 101 138 N/A INTRINSIC
low complexity region 186 210 N/A INTRINSIC
WH2 250 267 4.82e-3 SMART
low complexity region 295 309 N/A INTRINSIC
low complexity region 321 329 N/A INTRINSIC
SCOP:d1eq1a_ 360 427 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084114
SMART Domains Protein: ENSMUSP00000081131
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 101 138 N/A INTRINSIC
low complexity region 267 291 N/A INTRINSIC
WH2 331 348 4.82e-3 SMART
low complexity region 376 390 N/A INTRINSIC
low complexity region 402 410 N/A INTRINSIC
SCOP:d1eq1a_ 441 508 6e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103196
SMART Domains Protein: ENSMUSP00000099485
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 98 135 N/A INTRINSIC
low complexity region 183 207 N/A INTRINSIC
low complexity region 220 229 N/A INTRINSIC
WH2 238 255 4.82e-3 SMART
low complexity region 283 297 N/A INTRINSIC
low complexity region 309 317 N/A INTRINSIC
SCOP:d1eq1a_ 348 415 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105654
SMART Domains Protein: ENSMUSP00000101279
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 98 135 N/A INTRINSIC
low complexity region 264 288 N/A INTRINSIC
low complexity region 301 310 N/A INTRINSIC
WH2 319 336 4.82e-3 SMART
low complexity region 364 378 N/A INTRINSIC
low complexity region 390 398 N/A INTRINSIC
SCOP:d1eq1a_ 429 496 6e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105655
SMART Domains Protein: ENSMUSP00000101280
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 98 135 N/A INTRINSIC
low complexity region 183 207 N/A INTRINSIC
WH2 247 264 4.82e-3 SMART
low complexity region 292 306 N/A INTRINSIC
low complexity region 318 326 N/A INTRINSIC
SCOP:d1eq1a_ 357 424 3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105656
SMART Domains Protein: ENSMUSP00000101281
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 98 135 N/A INTRINSIC
low complexity region 264 288 N/A INTRINSIC
WH2 328 345 4.82e-3 SMART
low complexity region 373 387 N/A INTRINSIC
low complexity region 399 407 N/A INTRINSIC
SCOP:d1eq1a_ 438 505 8e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105657
SMART Domains Protein: ENSMUSP00000101282
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 101 138 N/A INTRINSIC
low complexity region 186 210 N/A INTRINSIC
low complexity region 223 232 N/A INTRINSIC
WH2 241 258 4.82e-3 SMART
low complexity region 286 300 N/A INTRINSIC
low complexity region 312 320 N/A INTRINSIC
SCOP:d1eq1a_ 351 418 2e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105658
AA Change: R250S

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101283
Gene: ENSMUSG00000028943
AA Change: R250S

DomainStartEndE-ValueType
ANK 35 64 3.26e0 SMART
ANK 69 99 1.15e0 SMART
ANK 103 133 2.58e-3 SMART
ANK 137 167 1.63e0 SMART
ANK 171 201 4.97e-5 SMART
ANK 205 235 3.08e-1 SMART
ANK 239 268 9.13e-4 SMART
ANK 271 300 2.15e0 SMART
ANK 304 334 2.08e3 SMART
low complexity region 377 395 N/A INTRINSIC
low complexity region 425 462 N/A INTRINSIC
low complexity region 591 615 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
WH2 646 663 4.82e-3 SMART
low complexity region 691 705 N/A INTRINSIC
low complexity region 717 725 N/A INTRINSIC
coiled coil region 749 825 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105659
AA Change: R250S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101284
Gene: ENSMUSG00000028943
AA Change: R250S

DomainStartEndE-ValueType
ANK 35 64 3.26e0 SMART
ANK 69 99 1.15e0 SMART
ANK 103 133 2.58e-3 SMART
ANK 137 167 1.63e0 SMART
ANK 171 201 4.97e-5 SMART
ANK 205 235 3.08e-1 SMART
ANK 239 268 9.13e-4 SMART
ANK 271 300 2.15e0 SMART
ANK 304 334 2.08e3 SMART
low complexity region 377 395 N/A INTRINSIC
low complexity region 428 465 N/A INTRINSIC
low complexity region 624 648 N/A INTRINSIC
low complexity region 661 670 N/A INTRINSIC
WH2 679 696 4.82e-3 SMART
low complexity region 724 738 N/A INTRINSIC
low complexity region 750 758 N/A INTRINSIC
coiled coil region 782 858 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000135185
AA Change: R152S

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122464
Gene: ENSMUSG00000028943
AA Change: R152S

DomainStartEndE-ValueType
ANK 5 35 2.58e-3 SMART
ANK 39 69 1.63e0 SMART
ANK 73 103 4.97e-5 SMART
ANK 107 137 3.08e-1 SMART
ANK 141 170 9.13e-4 SMART
ANK 173 202 2.15e0 SMART
ANK 206 236 2.08e3 SMART
low complexity region 279 297 N/A INTRINSIC
low complexity region 330 367 N/A INTRINSIC
low complexity region 496 520 N/A INTRINSIC
low complexity region 533 542 N/A INTRINSIC
WH2 551 568 4.82e-3 SMART
low complexity region 596 610 N/A INTRINSIC
low complexity region 622 630 N/A INTRINSIC
coiled coil region 654 685 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000207676
AA Change: R250S

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.0724 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 94% (98/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multifunctional actin-bundling protein. It plays a major role in regulating the organization, dimensions, dynamics, and signaling capacities of the actin filament-rich, microvillus-type specializations that mediate sensory transduction in various mechanosensory and chemosensory cells. Mutations in this gene are associated with autosomal recessive neurosensory deafness, and autosomal dominant sensorineural deafness without vestibular involvement. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit progressive degeneration of both inner and outer hair cells, severe deafness, vestibular dysfunction, and poor mothering ability. Heterozygotes show a progressive, age-related hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,455,423 S466P possibly damaging Het
1700061G19Rik A G 17: 56,888,655 N684S probably benign Het
4930435E12Rik A G 16: 38,828,145 S201P probably damaging Het
Ablim1 T C 19: 57,079,866 T267A probably damaging Het
Acap2 A T 16: 31,103,499 L724Q possibly damaging Het
Adcy4 T C 14: 55,781,927 T89A possibly damaging Het
Agrp T C 8: 105,567,368 E41G probably benign Het
Akap9 G A 5: 4,034,916 probably benign Het
Akr1d1 G A 6: 37,564,491 V308M probably damaging Het
Ap1m2 C T 9: 21,309,674 R54Q probably benign Het
Arhgap45 T A 10: 80,027,066 V692E probably damaging Het
Arid5b G T 10: 68,243,095 N137K probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
BC048679 T C 7: 81,495,720 N27D probably benign Het
Ccdc78 A G 17: 25,788,700 N237S probably benign Het
Cd46 G A 1: 195,062,396 L345F possibly damaging Het
Cngb3 A T 4: 19,425,569 N459I possibly damaging Het
Ctnnd2 A G 15: 30,881,167 E731G probably damaging Het
Cul1 G T 6: 47,517,146 K464N probably benign Het
Cul1 T A 6: 47,517,191 S479R probably damaging Het
Dcaf5 A T 12: 80,340,232 D373E probably benign Het
Ddx58 G T 4: 40,210,000 S644R probably damaging Het
Dhcr7 A G 7: 143,840,500 Q126R probably benign Het
Dnd1 C T 18: 36,765,963 probably benign Het
Dok2 T C 14: 70,777,516 F228L probably damaging Het
Dpep3 T G 8: 105,976,189 I314L probably benign Het
Eps8 A G 6: 137,514,295 F362L probably damaging Het
Faf1 A C 4: 109,742,896 N163H probably damaging Het
Fam198b C A 3: 79,936,674 S36* probably null Het
Fam71e2 C T 7: 4,757,469 probably null Het
Fcho1 C T 8: 71,710,481 V635I probably benign Het
Gm7579 G A 7: 142,211,908 C17Y unknown Het
Gm996 T C 2: 25,578,753 Y382C probably damaging Het
Gpx8 G T 13: 113,045,508 Y130* probably null Het
Grm6 C T 11: 50,864,612 T857M probably benign Het
Gvin1 A T 7: 106,163,436 Y609N possibly damaging Het
Hectd4 T A 5: 121,305,818 M30K probably benign Het
Ilkap A G 1: 91,387,383 probably benign Het
Iqub T C 6: 24,450,842 D586G probably damaging Het
Klhl22 G A 16: 17,777,016 silent Het
Klhl25 T C 7: 75,867,050 I568T probably benign Het
Krr1 C T 10: 111,985,691 probably benign Het
Larp6 A G 9: 60,737,810 E411G probably damaging Het
Lepr A C 4: 101,789,337 I822L probably benign Het
Lrig3 C A 10: 126,011,052 D896E probably benign Het
Lrp1 C T 10: 127,553,824 G3114D probably damaging Het
Macf1 A T 4: 123,486,750 Y1263N probably damaging Het
Mapk10 T C 5: 102,990,619 D180G probably damaging Het
Matr3 T A 18: 35,581,640 V113E probably damaging Het
Mbd4 A T 6: 115,848,926 F368Y possibly damaging Het
Mcpt8 G A 14: 56,082,280 R238W probably benign Het
Mcrip2 G T 17: 25,864,647 T86N possibly damaging Het
Mink1 A G 11: 70,611,592 N1043S probably damaging Het
Nbeal2 G A 9: 110,635,194 T1128I probably benign Het
Nrg2 T A 18: 36,196,547 Y205F probably damaging Het
Nsmce4a A T 7: 130,533,591 probably benign Het
Nubp2 A G 17: 24,884,456 M149T probably benign Het
Olfr1062 T C 2: 86,422,957 T240A probably damaging Het
Olfr462 T A 11: 87,889,225 M224L probably damaging Het
Olfr974 G T 9: 39,942,504 M81I probably benign Het
Pax3 A G 1: 78,192,456 I191T possibly damaging Het
Pdcd5 T C 7: 35,643,710 N137D possibly damaging Het
Pik3c2a G A 7: 116,340,156 A1649V probably damaging Het
Pik3r6 T A 11: 68,544,053 probably benign Het
Pkhd1l1 T C 15: 44,537,378 S2183P possibly damaging Het
Plekho1 T A 3: 95,988,993 Q388L possibly damaging Het
Ppfibp1 A G 6: 146,990,514 T91A probably benign Het
Ptger4 G T 15: 5,242,606 N177K probably benign Het
Reln A G 5: 21,901,751 F3207S probably benign Het
Ripk4 C T 16: 97,751,536 R194H probably damaging Het
Rnf112 A T 11: 61,452,744 C112S possibly damaging Het
Rprd1b T G 2: 158,074,935 Y278* probably null Het
Sel1l A G 12: 91,831,602 L140P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc38a3 A G 9: 107,655,064 V423A probably damaging Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Slmap A T 14: 26,460,209 V323E probably benign Het
Smim6 T C 11: 115,913,504 V39A probably benign Het
Snapc3 C T 4: 83,464,897 probably benign Het
Sorbs1 T C 19: 40,337,005 T382A probably benign Het
Sparc G A 11: 55,399,211 T218I possibly damaging Het
Steap1 A T 5: 5,736,589 F283I probably damaging Het
Stil A G 4: 115,038,474 T586A probably benign Het
Tango2 A G 16: 18,310,901 silent Het
Tbce T A 13: 14,019,795 D93V probably damaging Het
Tcf12 C T 9: 71,858,840 G504S probably null Het
Tle4 A T 19: 14,464,345 I435K probably benign Het
Tmem245 A G 4: 56,899,164 F254S probably damaging Het
Tmem251 A T 12: 102,744,055 probably benign Het
Tubgcp3 T C 8: 12,649,722 K377R probably benign Het
Ulk4 G A 9: 121,250,902 T497M possibly damaging Het
Ush2a A T 1: 188,553,275 T2003S probably benign Het
Usp53 A G 3: 122,961,363 S32P possibly damaging Het
Vmn1r78 T A 7: 12,152,756 L98Q probably damaging Het
Vmn2r84 T A 10: 130,385,843 D836V probably damaging Het
Vps13d A G 4: 145,087,161 F165L probably benign Het
Vstm4 A G 14: 32,863,785 E103G possibly damaging Het
Zfp384 G A 6: 125,030,930 silent Het
Zfp870 A T 17: 32,883,340 C339* probably null Het
Other mutations in Espn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Espn APN 4 152135602 missense probably damaging 1.00
IGL01404:Espn APN 4 152138444 missense probably benign 0.03
IGL01576:Espn APN 4 152123717 missense probably damaging 1.00
R0015:Espn UTSW 4 152139152 missense possibly damaging 0.77
R1475:Espn UTSW 4 152134271 missense probably damaging 1.00
R1773:Espn UTSW 4 152128229 missense probably damaging 1.00
R1992:Espn UTSW 4 152128555 critical splice acceptor site probably null
R2014:Espn UTSW 4 152132959 splice site probably null
R2049:Espn UTSW 4 152121257 missense probably damaging 0.99
R2281:Espn UTSW 4 152135545 missense possibly damaging 0.94
R4278:Espn UTSW 4 152134417 missense probably damaging 1.00
R4527:Espn UTSW 4 152135649 missense probably damaging 0.99
R4539:Espn UTSW 4 152134208 nonsense probably null
R4621:Espn UTSW 4 152131252 missense probably damaging 1.00
R4839:Espn UTSW 4 152138504 missense probably damaging 0.99
R4860:Espn UTSW 4 152138846 missense probably damaging 0.99
R4998:Espn UTSW 4 152135583 missense possibly damaging 0.94
R5412:Espn UTSW 4 152128125 missense probably damaging 1.00
R5570:Espn UTSW 4 152123780 missense probably damaging 1.00
R6549:Espn UTSW 4 152131068 start codon destroyed probably null 0.99
R6551:Espn UTSW 4 152128766
R7124:Espn UTSW 4 152131264 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAGCACTTCAGAGAAGCTG -3'
(R):5'- ACAACCCAGTCTTGGTGTGG -3'

Sequencing Primer
(F):5'- TTCAGAGAAGCTGCGAGGACATC -3'
(R):5'- TGGTGAGCTGAGGACCAC -3'
Posted On2016-04-15