Incidental Mutation 'R4860:Shroom3'
ID380162
Institutional Source Beutler Lab
Gene Symbol Shroom3
Ensembl Gene ENSMUSG00000029381
Gene Nameshroom family member 3
SynonymsD5Ertd287e, Shrm3, Shrm
MMRRC Submission 042471-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4860 (G1)
Quality Score104
Status Validated
Chromosome5
Chromosomal Location92683435-92965318 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 92943086 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 1151 (V1151F)
Ref Sequence ENSEMBL: ENSMUSP00000153516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113051] [ENSMUST00000113054] [ENSMUST00000113055] [ENSMUST00000168878] [ENSMUST00000172706] [ENSMUST00000225438]
Predicted Effect probably damaging
Transcript: ENSMUST00000113051
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108674
Gene: ENSMUSG00000029381
AA Change: V1057F

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
Pfam:ASD1 706 885 2.3e-65 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 1132 1143 N/A INTRINSIC
low complexity region 1172 1184 N/A INTRINSIC
low complexity region 1274 1288 N/A INTRINSIC
low complexity region 1333 1345 N/A INTRINSIC
Pfam:ASD2 1478 1765 3.1e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113054
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108677
Gene: ENSMUSG00000029381
AA Change: V1057F

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
Pfam:ASD1 706 885 2.3e-65 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 1132 1143 N/A INTRINSIC
low complexity region 1172 1184 N/A INTRINSIC
low complexity region 1274 1288 N/A INTRINSIC
low complexity region 1333 1345 N/A INTRINSIC
Pfam:ASD2 1478 1765 3.1e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113055
AA Change: V1232F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: V1232F

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
Pfam:ASD1 882 1060 1e-57 PFAM
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1307 1318 N/A INTRINSIC
low complexity region 1347 1359 N/A INTRINSIC
low complexity region 1449 1463 N/A INTRINSIC
low complexity region 1508 1520 N/A INTRINSIC
Pfam:ASD2 1654 1940 9.9e-112 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000168878
AA Change: V1101F
SMART Domains Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: V1101F

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
low complexity region 1176 1187 N/A INTRINSIC
low complexity region 1216 1228 N/A INTRINSIC
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1377 1389 N/A INTRINSIC
Pfam:ASD2 1522 1809 8.9e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172706
SMART Domains Protein: ENSMUSP00000133690
Gene: ENSMUSG00000029381

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201800
Predicted Effect probably damaging
Transcript: ENSMUST00000225438
AA Change: V1151F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 94% (98/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,455,423 S466P possibly damaging Het
1700061G19Rik A G 17: 56,888,655 N684S probably benign Het
4930435E12Rik A G 16: 38,828,145 S201P probably damaging Het
Ablim1 T C 19: 57,079,866 T267A probably damaging Het
Acap2 A T 16: 31,103,499 L724Q possibly damaging Het
Adcy4 T C 14: 55,781,927 T89A possibly damaging Het
Agrp T C 8: 105,567,368 E41G probably benign Het
Akap9 G A 5: 4,034,916 probably benign Het
Akr1d1 G A 6: 37,564,491 V308M probably damaging Het
Ap1m2 C T 9: 21,309,674 R54Q probably benign Het
Arhgap45 T A 10: 80,027,066 V692E probably damaging Het
Arid5b G T 10: 68,243,095 N137K probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
BC048679 T C 7: 81,495,720 N27D probably benign Het
Ccdc78 A G 17: 25,788,700 N237S probably benign Het
Cd46 G A 1: 195,062,396 L345F possibly damaging Het
Cngb3 A T 4: 19,425,569 N459I possibly damaging Het
Ctnnd2 A G 15: 30,881,167 E731G probably damaging Het
Cul1 G T 6: 47,517,146 K464N probably benign Het
Cul1 T A 6: 47,517,191 S479R probably damaging Het
Dcaf5 A T 12: 80,340,232 D373E probably benign Het
Ddx58 G T 4: 40,210,000 S644R probably damaging Het
Dhcr7 A G 7: 143,840,500 Q126R probably benign Het
Dnd1 C T 18: 36,765,963 probably benign Het
Dok2 T C 14: 70,777,516 F228L probably damaging Het
Dpep3 T G 8: 105,976,189 I314L probably benign Het
Eps8 A G 6: 137,514,295 F362L probably damaging Het
Espn G T 4: 152,138,846 R250S probably damaging Het
Faf1 A C 4: 109,742,896 N163H probably damaging Het
Fam198b C A 3: 79,936,674 S36* probably null Het
Fam71e2 C T 7: 4,757,469 probably null Het
Fcho1 C T 8: 71,710,481 V635I probably benign Het
Gm7579 G A 7: 142,211,908 C17Y unknown Het
Gm996 T C 2: 25,578,753 Y382C probably damaging Het
Gpx8 G T 13: 113,045,508 Y130* probably null Het
Grm6 C T 11: 50,864,612 T857M probably benign Het
Gvin1 A T 7: 106,163,436 Y609N possibly damaging Het
Hectd4 T A 5: 121,305,818 M30K probably benign Het
Ilkap A G 1: 91,387,383 probably benign Het
Iqub T C 6: 24,450,842 D586G probably damaging Het
Klhl22 G A 16: 17,777,016 silent Het
Klhl25 T C 7: 75,867,050 I568T probably benign Het
Krr1 C T 10: 111,985,691 probably benign Het
Larp6 A G 9: 60,737,810 E411G probably damaging Het
Lepr A C 4: 101,789,337 I822L probably benign Het
Lrig3 C A 10: 126,011,052 D896E probably benign Het
Lrp1 C T 10: 127,553,824 G3114D probably damaging Het
Macf1 A T 4: 123,486,750 Y1263N probably damaging Het
Mapk10 T C 5: 102,990,619 D180G probably damaging Het
Matr3 T A 18: 35,581,640 V113E probably damaging Het
Mbd4 A T 6: 115,848,926 F368Y possibly damaging Het
Mcpt8 G A 14: 56,082,280 R238W probably benign Het
Mcrip2 G T 17: 25,864,647 T86N possibly damaging Het
Mink1 A G 11: 70,611,592 N1043S probably damaging Het
Nbeal2 G A 9: 110,635,194 T1128I probably benign Het
Nrg2 T A 18: 36,196,547 Y205F probably damaging Het
Nsmce4a A T 7: 130,533,591 probably benign Het
Nubp2 A G 17: 24,884,456 M149T probably benign Het
Olfr1062 T C 2: 86,422,957 T240A probably damaging Het
Olfr462 T A 11: 87,889,225 M224L probably damaging Het
Olfr974 G T 9: 39,942,504 M81I probably benign Het
Pax3 A G 1: 78,192,456 I191T possibly damaging Het
Pdcd5 T C 7: 35,643,710 N137D possibly damaging Het
Pik3c2a G A 7: 116,340,156 A1649V probably damaging Het
Pik3r6 T A 11: 68,544,053 probably benign Het
Pkhd1l1 T C 15: 44,537,378 S2183P possibly damaging Het
Plekho1 T A 3: 95,988,993 Q388L possibly damaging Het
Ppfibp1 A G 6: 146,990,514 T91A probably benign Het
Ptger4 G T 15: 5,242,606 N177K probably benign Het
Reln A G 5: 21,901,751 F3207S probably benign Het
Ripk4 C T 16: 97,751,536 R194H probably damaging Het
Rnf112 A T 11: 61,452,744 C112S possibly damaging Het
Rprd1b T G 2: 158,074,935 Y278* probably null Het
Sel1l A G 12: 91,831,602 L140P probably damaging Het
Slc38a3 A G 9: 107,655,064 V423A probably damaging Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Slmap A T 14: 26,460,209 V323E probably benign Het
Smim6 T C 11: 115,913,504 V39A probably benign Het
Snapc3 C T 4: 83,464,897 probably benign Het
Sorbs1 T C 19: 40,337,005 T382A probably benign Het
Sparc G A 11: 55,399,211 T218I possibly damaging Het
Steap1 A T 5: 5,736,589 F283I probably damaging Het
Stil A G 4: 115,038,474 T586A probably benign Het
Tango2 A G 16: 18,310,901 silent Het
Tbce T A 13: 14,019,795 D93V probably damaging Het
Tcf12 C T 9: 71,858,840 G504S probably null Het
Tle4 A T 19: 14,464,345 I435K probably benign Het
Tmem245 A G 4: 56,899,164 F254S probably damaging Het
Tmem251 A T 12: 102,744,055 probably benign Het
Tubgcp3 T C 8: 12,649,722 K377R probably benign Het
Ulk4 G A 9: 121,250,902 T497M possibly damaging Het
Ush2a A T 1: 188,553,275 T2003S probably benign Het
Usp53 A G 3: 122,961,363 S32P possibly damaging Het
Vmn1r78 T A 7: 12,152,756 L98Q probably damaging Het
Vmn2r84 T A 10: 130,385,843 D836V probably damaging Het
Vps13d A G 4: 145,087,161 F165L probably benign Het
Vstm4 A G 14: 32,863,785 E103G possibly damaging Het
Zfp384 G A 6: 125,030,930 silent Het
Zfp870 A T 17: 32,883,340 C339* probably null Het
Other mutations in Shroom3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Shroom3 APN 5 92951065 missense probably damaging 1.00
IGL01086:Shroom3 APN 5 92948452 missense probably benign 0.01
IGL01363:Shroom3 APN 5 92940993 missense probably benign 0.01
IGL01468:Shroom3 APN 5 92940342 missense probably damaging 1.00
IGL01675:Shroom3 APN 5 92941680 missense probably damaging 0.99
IGL01862:Shroom3 APN 5 92962289 missense probably damaging 1.00
IGL01987:Shroom3 APN 5 92942189 missense probably damaging 0.99
IGL02104:Shroom3 APN 5 92940389 missense probably benign 0.32
IGL03248:Shroom3 APN 5 92952540 missense probably benign 0.00
IGL03386:Shroom3 APN 5 92948483 splice site probably benign
R0167:Shroom3 UTSW 5 92948395 splice site probably benign
R0388:Shroom3 UTSW 5 92951293 missense probably benign 0.39
R0395:Shroom3 UTSW 5 92780903 missense probably damaging 1.00
R0567:Shroom3 UTSW 5 92964453 missense possibly damaging 0.53
R1496:Shroom3 UTSW 5 92942834 missense possibly damaging 0.69
R1772:Shroom3 UTSW 5 92940656 missense probably damaging 0.97
R1845:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R1921:Shroom3 UTSW 5 92962365 critical splice donor site probably null
R2059:Shroom3 UTSW 5 92683784 missense probably damaging 1.00
R2203:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2204:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2205:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2301:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2344:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2345:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2346:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2348:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2371:Shroom3 UTSW 5 92780870 missense probably damaging 1.00
R2435:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2829:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2830:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2831:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2897:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2898:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3079:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3080:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3433:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3729:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3730:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3735:Shroom3 UTSW 5 92964444 missense possibly damaging 0.84
R3736:Shroom3 UTSW 5 92964444 missense possibly damaging 0.84
R3851:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3852:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3943:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3969:Shroom3 UTSW 5 92940879 missense probably benign 0.05
R4008:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4009:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4012:Shroom3 UTSW 5 92948483 splice site probably benign
R4154:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4157:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4172:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4173:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4201:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4202:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4204:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4205:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4206:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4284:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4285:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4364:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4384:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4456:Shroom3 UTSW 5 92940999 missense probably benign 0.14
R4707:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4712:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4751:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4755:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4760:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4773:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4774:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4776:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4801:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4802:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4856:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4857:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4860:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4882:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4883:Shroom3 UTSW 5 92951134 missense probably benign 0.14
R4886:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R5262:Shroom3 UTSW 5 92964573 missense probably damaging 1.00
R5271:Shroom3 UTSW 5 92962248 missense probably damaging 1.00
R5719:Shroom3 UTSW 5 92943018 missense probably benign 0.04
R5726:Shroom3 UTSW 5 92943005 missense probably benign 0.00
R5993:Shroom3 UTSW 5 92940188 missense probably damaging 1.00
R6078:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R6079:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R6138:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R6153:Shroom3 UTSW 5 92964408 missense probably damaging 0.99
R6493:Shroom3 UTSW 5 92941561 missense probably benign 0.03
R6495:Shroom3 UTSW 5 92942069 missense possibly damaging 0.66
R6693:Shroom3 UTSW 5 92940758 missense possibly damaging 0.61
R6801:Shroom3 UTSW 5 92940936 missense probably damaging 1.00
R6893:Shroom3 UTSW 5 92942204 missense probably damaging 0.97
R6912:Shroom3 UTSW 5 92943017 missense probably benign 0.02
R6924:Shroom3 UTSW 5 92964403 missense probably damaging 1.00
R7083:Shroom3 UTSW 5 92964525 missense probably damaging 1.00
R7197:Shroom3 UTSW 5 92942604 missense probably damaging 1.00
R7366:Shroom3 UTSW 5 92964606 nonsense probably null
R7712:Shroom3 UTSW 5 92950947 missense probably benign 0.01
R7725:Shroom3 UTSW 5 92941653 missense probably benign 0.19
R7728:Shroom3 UTSW 5 92683707 missense possibly damaging 0.73
R7774:Shroom3 UTSW 5 92950489 missense probably damaging 0.98
R7795:Shroom3 UTSW 5 92919649 missense probably damaging 0.99
R7821:Shroom3 UTSW 5 92940846 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGGAGCACACTCATCCGTC -3'
(R):5'- TGTCAGAACGGTAACCAACC -3'

Sequencing Primer
(F):5'- GTGATCGCAGCAGCTCCTTC -3'
(R):5'- AGACATTTATATATCTTTGTGCGGG -3'
Posted On2016-04-15