Mutagenetix > Incidental Mutation

Incidental Mutation 'R4860:Shroom3'

380162

Institutional Source

Beutler Lab

Gene Symbol

Shroom3

Ensembl Gene

ENSMUSG00000029381

Gene Name

shroom family member 3

Synonyms

D5Ertd287e, Shrm3, Shrm

MMRRC Submission

042471-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4860 (G1)

Quality Score

104

Status

Validated

Chromosome

Chromosomal Location

92683435-92965318 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 92943086 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 1151 (V1151F)

Ref Sequence

ENSEMBL: ENSMUSP00000153516 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113051] [ENSMUST00000113054] [ENSMUST00000113055] [ENSMUST00000168878] [ENSMUST00000172706] [ENSMUST00000225438]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000113051
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108674
Gene: ENSMUSG00000029381
AA Change: V1057F

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC
low complexity region	572	586	N/A	INTRINSIC
low complexity region	621	639	N/A	INTRINSIC
low complexity region	685	704	N/A	INTRINSIC
Pfam:ASD1	706	885	2.3e-65	PFAM
low complexity region	939	952	N/A	INTRINSIC
low complexity region	1132	1143	N/A	INTRINSIC
low complexity region	1172	1184	N/A	INTRINSIC
low complexity region	1274	1288	N/A	INTRINSIC
low complexity region	1333	1345	N/A	INTRINSIC
Pfam:ASD2	1478	1765	3.1e-107	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113054
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108677
Gene: ENSMUSG00000029381
AA Change: V1057F

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC
low complexity region	572	586	N/A	INTRINSIC
low complexity region	621	639	N/A	INTRINSIC
low complexity region	685	704	N/A	INTRINSIC
Pfam:ASD1	706	885	2.3e-65	PFAM
low complexity region	939	952	N/A	INTRINSIC
low complexity region	1132	1143	N/A	INTRINSIC
low complexity region	1172	1184	N/A	INTRINSIC
low complexity region	1274	1288	N/A	INTRINSIC
low complexity region	1333	1345	N/A	INTRINSIC
Pfam:ASD2	1478	1765	3.1e-107	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113055
AA Change: V1232F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: V1232F

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
Pfam:ASD1	882	1060	1e-57	PFAM
low complexity region	1114	1127	N/A	INTRINSIC
low complexity region	1307	1318	N/A	INTRINSIC
low complexity region	1347	1359	N/A	INTRINSIC
low complexity region	1449	1463	N/A	INTRINSIC
low complexity region	1508	1520	N/A	INTRINSIC
Pfam:ASD2	1654	1940	9.9e-112	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000168878
AA Change: V1101F

SMART Domains

Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: V1101F

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
low complexity region	983	996	N/A	INTRINSIC
low complexity region	1176	1187	N/A	INTRINSIC
low complexity region	1216	1228	N/A	INTRINSIC
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1377	1389	N/A	INTRINSIC
Pfam:ASD2	1522	1809	8.9e-108	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172706

SMART Domains

Protein: ENSMUSP00000133690
Gene: ENSMUSG00000029381

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200869

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201800

Predicted Effect

probably damaging
Transcript: ENSMUST00000225438
AA Change: V1151F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.6%

Validation Efficiency

94% (98/104)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030K09Rik	T	C	8: 72,455,423	S466P	possibly damaging	Het
1700061G19Rik	A	G	17: 56,888,655	N684S	probably benign	Het
4930435E12Rik	A	G	16: 38,828,145	S201P	probably damaging	Het
Ablim1	T	C	19: 57,079,866	T267A	probably damaging	Het
Acap2	A	T	16: 31,103,499	L724Q	possibly damaging	Het
Adcy4	T	C	14: 55,781,927	T89A	possibly damaging	Het
Agrp	T	C	8: 105,567,368	E41G	probably benign	Het
Akap9	G	A	5: 4,034,916		probably benign	Het
Akr1d1	G	A	6: 37,564,491	V308M	probably damaging	Het
Ap1m2	C	T	9: 21,309,674	R54Q	probably benign	Het
Arhgap45	T	A	10: 80,027,066	V692E	probably damaging	Het
Arid5b	G	T	10: 68,243,095	N137K	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
BC048679	T	C	7: 81,495,720	N27D	probably benign	Het
Ccdc78	A	G	17: 25,788,700	N237S	probably benign	Het
Cd46	G	A	1: 195,062,396	L345F	possibly damaging	Het
Cngb3	A	T	4: 19,425,569	N459I	possibly damaging	Het
Ctnnd2	A	G	15: 30,881,167	E731G	probably damaging	Het
Cul1	G	T	6: 47,517,146	K464N	probably benign	Het
Cul1	T	A	6: 47,517,191	S479R	probably damaging	Het
Dcaf5	A	T	12: 80,340,232	D373E	probably benign	Het
Ddx58	G	T	4: 40,210,000	S644R	probably damaging	Het
Dhcr7	A	G	7: 143,840,500	Q126R	probably benign	Het
Dnd1	C	T	18: 36,765,963		probably benign	Het
Dok2	T	C	14: 70,777,516	F228L	probably damaging	Het
Dpep3	T	G	8: 105,976,189	I314L	probably benign	Het
Eps8	A	G	6: 137,514,295	F362L	probably damaging	Het
Espn	G	T	4: 152,138,846	R250S	probably damaging	Het
Faf1	A	C	4: 109,742,896	N163H	probably damaging	Het
Fam198b	C	A	3: 79,936,674	S36*	probably null	Het
Fam71e2	C	T	7: 4,757,469		probably null	Het
Fcho1	C	T	8: 71,710,481	V635I	probably benign	Het
Gm7579	G	A	7: 142,211,908	C17Y	unknown	Het
Gm996	T	C	2: 25,578,753	Y382C	probably damaging	Het
Gpx8	G	T	13: 113,045,508	Y130*	probably null	Het
Grm6	C	T	11: 50,864,612	T857M	probably benign	Het
Gvin1	A	T	7: 106,163,436	Y609N	possibly damaging	Het
Hectd4	T	A	5: 121,305,818	M30K	probably benign	Het
Ilkap	A	G	1: 91,387,383		probably benign	Het
Iqub	T	C	6: 24,450,842	D586G	probably damaging	Het
Klhl22	G	A	16: 17,777,016		silent	Het
Klhl25	T	C	7: 75,867,050	I568T	probably benign	Het
Krr1	C	T	10: 111,985,691		probably benign	Het
Larp6	A	G	9: 60,737,810	E411G	probably damaging	Het
Lepr	A	C	4: 101,789,337	I822L	probably benign	Het
Lrig3	C	A	10: 126,011,052	D896E	probably benign	Het
Lrp1	C	T	10: 127,553,824	G3114D	probably damaging	Het
Macf1	A	T	4: 123,486,750	Y1263N	probably damaging	Het
Mapk10	T	C	5: 102,990,619	D180G	probably damaging	Het
Matr3	T	A	18: 35,581,640	V113E	probably damaging	Het
Mbd4	A	T	6: 115,848,926	F368Y	possibly damaging	Het
Mcpt8	G	A	14: 56,082,280	R238W	probably benign	Het
Mcrip2	G	T	17: 25,864,647	T86N	possibly damaging	Het
Mink1	A	G	11: 70,611,592	N1043S	probably damaging	Het
Nbeal2	G	A	9: 110,635,194	T1128I	probably benign	Het
Nrg2	T	A	18: 36,196,547	Y205F	probably damaging	Het
Nsmce4a	A	T	7: 130,533,591		probably benign	Het
Nubp2	A	G	17: 24,884,456	M149T	probably benign	Het
Olfr1062	T	C	2: 86,422,957	T240A	probably damaging	Het
Olfr462	T	A	11: 87,889,225	M224L	probably damaging	Het
Olfr974	G	T	9: 39,942,504	M81I	probably benign	Het
Pax3	A	G	1: 78,192,456	I191T	possibly damaging	Het
Pdcd5	T	C	7: 35,643,710	N137D	possibly damaging	Het
Pik3c2a	G	A	7: 116,340,156	A1649V	probably damaging	Het
Pik3r6	T	A	11: 68,544,053		probably benign	Het
Pkhd1l1	T	C	15: 44,537,378	S2183P	possibly damaging	Het
Plekho1	T	A	3: 95,988,993	Q388L	possibly damaging	Het
Ppfibp1	A	G	6: 146,990,514	T91A	probably benign	Het
Ptger4	G	T	15: 5,242,606	N177K	probably benign	Het
Reln	A	G	5: 21,901,751	F3207S	probably benign	Het
Ripk4	C	T	16: 97,751,536	R194H	probably damaging	Het
Rnf112	A	T	11: 61,452,744	C112S	possibly damaging	Het
Rprd1b	T	G	2: 158,074,935	Y278*	probably null	Het
Sel1l	A	G	12: 91,831,602	L140P	probably damaging	Het
Slc38a3	A	G	9: 107,655,064	V423A	probably damaging	Het
Slitrk6	T	C	14: 110,751,883	T131A	probably damaging	Het
Slmap	A	T	14: 26,460,209	V323E	probably benign	Het
Smim6	T	C	11: 115,913,504	V39A	probably benign	Het
Snapc3	C	T	4: 83,464,897		probably benign	Het
Sorbs1	T	C	19: 40,337,005	T382A	probably benign	Het
Sparc	G	A	11: 55,399,211	T218I	possibly damaging	Het
Steap1	A	T	5: 5,736,589	F283I	probably damaging	Het
Stil	A	G	4: 115,038,474	T586A	probably benign	Het
Tango2	A	G	16: 18,310,901		silent	Het
Tbce	T	A	13: 14,019,795	D93V	probably damaging	Het
Tcf12	C	T	9: 71,858,840	G504S	probably null	Het
Tle4	A	T	19: 14,464,345	I435K	probably benign	Het
Tmem245	A	G	4: 56,899,164	F254S	probably damaging	Het
Tmem251	A	T	12: 102,744,055		probably benign	Het
Tubgcp3	T	C	8: 12,649,722	K377R	probably benign	Het
Ulk4	G	A	9: 121,250,902	T497M	possibly damaging	Het
Ush2a	A	T	1: 188,553,275	T2003S	probably benign	Het
Usp53	A	G	3: 122,961,363	S32P	possibly damaging	Het
Vmn1r78	T	A	7: 12,152,756	L98Q	probably damaging	Het
Vmn2r84	T	A	10: 130,385,843	D836V	probably damaging	Het
Vps13d	A	G	4: 145,087,161	F165L	probably benign	Het
Vstm4	A	G	14: 32,863,785	E103G	possibly damaging	Het
Zfp384	G	A	6: 125,030,930		silent	Het
Zfp870	A	T	17: 32,883,340	C339*	probably null	Het

Other mutations in Shroom3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:Shroom3	APN	5	92951065	missense	probably damaging	1.00
IGL01086:Shroom3	APN	5	92948452	missense	probably benign	0.01
IGL01363:Shroom3	APN	5	92940993	missense	probably benign	0.01
IGL01468:Shroom3	APN	5	92940342	missense	probably damaging	1.00
IGL01675:Shroom3	APN	5	92941680	missense	probably damaging	0.99
IGL01862:Shroom3	APN	5	92962289	missense	probably damaging	1.00
IGL01987:Shroom3	APN	5	92942189	missense	probably damaging	0.99
IGL02104:Shroom3	APN	5	92940389	missense	probably benign	0.32
IGL03248:Shroom3	APN	5	92952540	missense	probably benign	0.00
IGL03386:Shroom3	APN	5	92948483	splice site	probably benign
R0167:Shroom3	UTSW	5	92948395	splice site	probably benign
R0388:Shroom3	UTSW	5	92951293	missense	probably benign	0.39
R0395:Shroom3	UTSW	5	92780903	missense	probably damaging	1.00
R0567:Shroom3	UTSW	5	92964453	missense	possibly damaging	0.53
R1496:Shroom3	UTSW	5	92942834	missense	possibly damaging	0.69
R1772:Shroom3	UTSW	5	92940656	missense	probably damaging	0.97
R1845:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R1921:Shroom3	UTSW	5	92962365	critical splice donor site	probably null
R2059:Shroom3	UTSW	5	92683784	missense	probably damaging	1.00
R2203:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2301:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2344:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2345:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2346:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2348:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2371:Shroom3	UTSW	5	92780870	missense	probably damaging	1.00
R2435:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2829:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2830:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2831:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2897:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2898:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3080:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3433:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3729:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3730:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3735:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3736:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3851:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3852:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3943:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3969:Shroom3	UTSW	5	92940879	missense	probably benign	0.05
R4008:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4009:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4012:Shroom3	UTSW	5	92948483	splice site	probably benign
R4154:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4157:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4172:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4173:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4201:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4202:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4206:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4284:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4285:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4364:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4384:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4456:Shroom3	UTSW	5	92940999	missense	probably benign	0.14
R4707:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4712:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4751:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4755:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4760:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4773:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4774:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4776:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4801:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4802:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4856:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4857:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4882:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4883:Shroom3	UTSW	5	92951134	missense	probably benign	0.14
R4886:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R5262:Shroom3	UTSW	5	92964573	missense	probably damaging	1.00
R5271:Shroom3	UTSW	5	92962248	missense	probably damaging	1.00
R5719:Shroom3	UTSW	5	92943018	missense	probably benign	0.04
R5726:Shroom3	UTSW	5	92943005	missense	probably benign	0.00
R5993:Shroom3	UTSW	5	92940188	missense	probably damaging	1.00
R6078:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6138:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6153:Shroom3	UTSW	5	92964408	missense	probably damaging	0.99
R6493:Shroom3	UTSW	5	92941561	missense	probably benign	0.03
R6495:Shroom3	UTSW	5	92942069	missense	possibly damaging	0.66
R6693:Shroom3	UTSW	5	92940758	missense	possibly damaging	0.61
R6801:Shroom3	UTSW	5	92940936	missense	probably damaging	1.00
R6893:Shroom3	UTSW	5	92942204	missense	probably damaging	0.97
R6912:Shroom3	UTSW	5	92943017	missense	probably benign	0.02
R6924:Shroom3	UTSW	5	92964403	missense	probably damaging	1.00
R7083:Shroom3	UTSW	5	92964525	missense	probably damaging	1.00
R7197:Shroom3	UTSW	5	92942604	missense	probably damaging	1.00
R7366:Shroom3	UTSW	5	92964606	nonsense	probably null
R7712:Shroom3	UTSW	5	92950947	missense	probably benign	0.01
R7725:Shroom3	UTSW	5	92941653	missense	probably benign	0.19
R7728:Shroom3	UTSW	5	92683707	missense	possibly damaging	0.73
R7774:Shroom3	UTSW	5	92950489	missense	probably damaging	0.98
R7795:Shroom3	UTSW	5	92919649	missense	probably damaging	0.99
R7821:Shroom3	UTSW	5	92940846	missense	probably damaging	0.98
R7971:Shroom3	UTSW	5	92951074	missense	probably damaging	1.00
R8276:Shroom3	UTSW	5	92940480	missense	probably damaging	0.99
R8934:Shroom3	UTSW	5	92941725	missense	probably damaging	1.00
R8938:Shroom3	UTSW	5	92943071	missense	probably damaging	1.00
R9083:Shroom3	UTSW	5	92950674	missense	probably damaging	0.97
R9108:Shroom3	UTSW	5	92940116	missense	probably damaging	1.00
R9124:Shroom3	UTSW	5	92964542	missense	probably benign	0.19
R9295:Shroom3	UTSW	5	92950619	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAGGAGCACACTCATCCGTC -3'
(R):5'- TGTCAGAACGGTAACCAACC -3'

Sequencing Primer
(F):5'- GTGATCGCAGCAGCTCCTTC -3'
(R):5'- AGACATTTATATATCTTTGTGCGGG -3'

Posted On

2016-04-15