Mutagenetix > Incidental Mutations

Incidental Mutation 'R4860:Arid5b'

380193

Institutional Source

Beutler Lab

Gene Symbol

Arid5b

Ensembl Gene

ENSMUSG00000019947

Gene Name

AT rich interactive domain 5B (MRF1-like)

Synonyms

5430435G07Rik, Mrf2beta, Mrf2alpha, Mrf2, Desrt

MMRRC Submission

042471-MU

Accession Numbers

Genbank: NM_023598; MGI: 2175912

Is this an essential gene?

Probably essential (E-score: 0.937) question?

Stock #

R4860 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

68092520-68278740 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 68243095 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 137 (N137K)

Ref Sequence

ENSEMBL: ENSMUSP00000151227 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020106] [ENSMUST00000219238]

AlphaFold

Q8BM75

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020106
AA Change: N137K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000020106
Gene: ENSMUSG00000019947
AA Change: N137K

Domain	Start	End	E-Value	Type
ARID	316	407	8.29e-35	SMART
BRIGHT	320	412	4.18e-38	SMART
low complexity region	425	438	N/A	INTRINSIC
low complexity region	451	462	N/A	INTRINSIC
low complexity region	538	549	N/A	INTRINSIC
low complexity region	695	718	N/A	INTRINSIC
low complexity region	730	741	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218425

Predicted Effect

probably damaging
Transcript: ENSMUST00000219238
AA Change: N137K

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.6%

Validation Efficiency

94% (98/104)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interaction domain (ARID) family of DNA binding proteins. The encoded protein forms a histone H3K9Me2 demethylase complex with PHD finger protein 2 and regulates the transcription of target genes involved in adipogenesis and liver development. This gene also plays a role in cell growth and differentiation of B-lymphocyte progenitors, and single nucleotide polymorphisms in this gene are associated with acute lymphoblastic leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene experience a high level of mortality perinatally or earlier. Growth rates are low and mice remain small throughout live. There are abnormalities in various organ systems as well as the reproductive system. Fertility is reduced. [provided by MGI curators]

Allele List at MGI

All alleles(212) : Targeted, knock-out(2) Gene trapped(210)

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030K09Rik	T	C	8: 72,455,423	S466P	possibly damaging	Het
1700061G19Rik	A	G	17: 56,888,655	N684S	probably benign	Het
4930435E12Rik	A	G	16: 38,828,145	S201P	probably damaging	Het
Ablim1	T	C	19: 57,079,866	T267A	probably damaging	Het
Acap2	A	T	16: 31,103,499	L724Q	possibly damaging	Het
Adcy4	T	C	14: 55,781,927	T89A	possibly damaging	Het
Agrp	T	C	8: 105,567,368	E41G	probably benign	Het
Akap9	G	A	5: 4,034,916		probably benign	Het
Akr1d1	G	A	6: 37,564,491	V308M	probably damaging	Het
Ap1m2	C	T	9: 21,309,674	R54Q	probably benign	Het
Arhgap45	T	A	10: 80,027,066	V692E	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
BC048679	T	C	7: 81,495,720	N27D	probably benign	Het
Ccdc78	A	G	17: 25,788,700	N237S	probably benign	Het
Cd46	G	A	1: 195,062,396	L345F	possibly damaging	Het
Cngb3	A	T	4: 19,425,569	N459I	possibly damaging	Het
Ctnnd2	A	G	15: 30,881,167	E731G	probably damaging	Het
Cul1	G	T	6: 47,517,146	K464N	probably benign	Het
Cul1	T	A	6: 47,517,191	S479R	probably damaging	Het
Dcaf5	A	T	12: 80,340,232	D373E	probably benign	Het
Ddx58	G	T	4: 40,210,000	S644R	probably damaging	Het
Dhcr7	A	G	7: 143,840,500	Q126R	probably benign	Het
Dnd1	C	T	18: 36,765,963		probably benign	Het
Dok2	T	C	14: 70,777,516	F228L	probably damaging	Het
Dpep3	T	G	8: 105,976,189	I314L	probably benign	Het
Eps8	A	G	6: 137,514,295	F362L	probably damaging	Het
Espn	G	T	4: 152,138,846	R250S	probably damaging	Het
Faf1	A	C	4: 109,742,896	N163H	probably damaging	Het
Fam198b	C	A	3: 79,936,674	S36*	probably null	Het
Fam71e2	C	T	7: 4,757,469		probably null	Het
Fcho1	C	T	8: 71,710,481	V635I	probably benign	Het
Gm7579	G	A	7: 142,211,908	C17Y	unknown	Het
Gm996	T	C	2: 25,578,753	Y382C	probably damaging	Het
Gpx8	G	T	13: 113,045,508	Y130*	probably null	Het
Grm6	C	T	11: 50,864,612	T857M	probably benign	Het
Gvin1	A	T	7: 106,163,436	Y609N	possibly damaging	Het
Hectd4	T	A	5: 121,305,818	M30K	probably benign	Het
Ilkap	A	G	1: 91,387,383		probably benign	Het
Iqub	T	C	6: 24,450,842	D586G	probably damaging	Het
Klhl22	G	A	16: 17,777,016		silent	Het
Klhl25	T	C	7: 75,867,050	I568T	probably benign	Het
Krr1	C	T	10: 111,985,691		probably benign	Het
Larp6	A	G	9: 60,737,810	E411G	probably damaging	Het
Lepr	A	C	4: 101,789,337	I822L	probably benign	Het
Lrig3	C	A	10: 126,011,052	D896E	probably benign	Het
Lrp1	C	T	10: 127,553,824	G3114D	probably damaging	Het
Macf1	A	T	4: 123,486,750	Y1263N	probably damaging	Het
Mapk10	T	C	5: 102,990,619	D180G	probably damaging	Het
Matr3	T	A	18: 35,581,640	V113E	probably damaging	Het
Mbd4	A	T	6: 115,848,926	F368Y	possibly damaging	Het
Mcpt8	G	A	14: 56,082,280	R238W	probably benign	Het
Mcrip2	G	T	17: 25,864,647	T86N	possibly damaging	Het
Mink1	A	G	11: 70,611,592	N1043S	probably damaging	Het
Nbeal2	G	A	9: 110,635,194	T1128I	probably benign	Het
Nrg2	T	A	18: 36,196,547	Y205F	probably damaging	Het
Nsmce4a	A	T	7: 130,533,591		probably benign	Het
Nubp2	A	G	17: 24,884,456	M149T	probably benign	Het
Olfr1062	T	C	2: 86,422,957	T240A	probably damaging	Het
Olfr462	T	A	11: 87,889,225	M224L	probably damaging	Het
Olfr974	G	T	9: 39,942,504	M81I	probably benign	Het
Pax3	A	G	1: 78,192,456	I191T	possibly damaging	Het
Pdcd5	T	C	7: 35,643,710	N137D	possibly damaging	Het
Pik3c2a	G	A	7: 116,340,156	A1649V	probably damaging	Het
Pik3r6	T	A	11: 68,544,053		probably benign	Het
Pkhd1l1	T	C	15: 44,537,378	S2183P	possibly damaging	Het
Plekho1	T	A	3: 95,988,993	Q388L	possibly damaging	Het
Ppfibp1	A	G	6: 146,990,514	T91A	probably benign	Het
Ptger4	G	T	15: 5,242,606	N177K	probably benign	Het
Reln	A	G	5: 21,901,751	F3207S	probably benign	Het
Ripk4	C	T	16: 97,751,536	R194H	probably damaging	Het
Rnf112	A	T	11: 61,452,744	C112S	possibly damaging	Het
Rprd1b	T	G	2: 158,074,935	Y278*	probably null	Het
Sel1l	A	G	12: 91,831,602	L140P	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slc38a3	A	G	9: 107,655,064	V423A	probably damaging	Het
Slitrk6	T	C	14: 110,751,883	T131A	probably damaging	Het
Slmap	A	T	14: 26,460,209	V323E	probably benign	Het
Smim6	T	C	11: 115,913,504	V39A	probably benign	Het
Snapc3	C	T	4: 83,464,897		probably benign	Het
Sorbs1	T	C	19: 40,337,005	T382A	probably benign	Het
Sparc	G	A	11: 55,399,211	T218I	possibly damaging	Het
Steap1	A	T	5: 5,736,589	F283I	probably damaging	Het
Stil	A	G	4: 115,038,474	T586A	probably benign	Het
Tango2	A	G	16: 18,310,901		silent	Het
Tbce	T	A	13: 14,019,795	D93V	probably damaging	Het
Tcf12	C	T	9: 71,858,840	G504S	probably null	Het
Tle4	A	T	19: 14,464,345	I435K	probably benign	Het
Tmem245	A	G	4: 56,899,164	F254S	probably damaging	Het
Tmem251	A	T	12: 102,744,055		probably benign	Het
Tubgcp3	T	C	8: 12,649,722	K377R	probably benign	Het
Ulk4	G	A	9: 121,250,902	T497M	possibly damaging	Het
Ush2a	A	T	1: 188,553,275	T2003S	probably benign	Het
Usp53	A	G	3: 122,961,363	S32P	possibly damaging	Het
Vmn1r78	T	A	7: 12,152,756	L98Q	probably damaging	Het
Vmn2r84	T	A	10: 130,385,843	D836V	probably damaging	Het
Vps13d	A	G	4: 145,087,161	F165L	probably benign	Het
Vstm4	A	G	14: 32,863,785	E103G	possibly damaging	Het
Zfp384	G	A	6: 125,030,930		silent	Het
Zfp870	A	T	17: 32,883,340	C339*	probably null	Het

Other mutations in Arid5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Arid5b	APN	10	68128975	missense	probably damaging	0.96
IGL01731:Arid5b	APN	10	68097609	missense	probably damaging	1.00
IGL02069:Arid5b	APN	10	68097399	missense	probably damaging	1.00
IGL02161:Arid5b	APN	10	68096668	missense	probably benign	0.00
IGL02555:Arid5b	APN	10	68101904	missense	probably benign	0.01
IGL02873:Arid5b	APN	10	68101950	missense	probably benign	0.06
IGL03119:Arid5b	APN	10	68243227	missense	probably damaging	1.00
IGL03271:Arid5b	APN	10	68097457	missense	possibly damaging	0.73
gobi	UTSW	10	68118345	missense	possibly damaging	0.92
3-1:Arid5b	UTSW	10	68098589	missense	probably damaging	1.00
PIT4677001:Arid5b	UTSW	10	68098011	missense	probably damaging	0.99
R0108:Arid5b	UTSW	10	68278729	utr 5 prime	probably benign
R0525:Arid5b	UTSW	10	68097846	missense	possibly damaging	0.90
R0533:Arid5b	UTSW	10	68186033	missense	probably damaging	1.00
R0646:Arid5b	UTSW	10	68096977	missense	probably damaging	1.00
R1066:Arid5b	UTSW	10	68098356	missense	probably benign	0.04
R1487:Arid5b	UTSW	10	68097214	nonsense	probably null
R1638:Arid5b	UTSW	10	68277947	missense	possibly damaging	0.48
R1789:Arid5b	UTSW	10	68186067	missense	probably damaging	0.99
R2031:Arid5b	UTSW	10	68278688	critical splice donor site	probably null
R2337:Arid5b	UTSW	10	68097777	missense	possibly damaging	0.63
R2996:Arid5b	UTSW	10	68098462	missense	probably benign	0.01
R2997:Arid5b	UTSW	10	68098462	missense	probably benign	0.01
R3547:Arid5b	UTSW	10	68098462	missense	probably benign	0.01
R4411:Arid5b	UTSW	10	68096689	missense	probably damaging	1.00
R4860:Arid5b	UTSW	10	68243095	missense	probably damaging	0.97
R5219:Arid5b	UTSW	10	68278110	missense	probably benign	0.08
R5341:Arid5b	UTSW	10	68278127	missense	possibly damaging	0.87
R5434:Arid5b	UTSW	10	68096889	missense	possibly damaging	0.67
R5757:Arid5b	UTSW	10	68102079	missense	probably damaging	1.00
R6114:Arid5b	UTSW	10	68097744	missense	possibly damaging	0.89
R6313:Arid5b	UTSW	10	68097582	missense	possibly damaging	0.95
R6338:Arid5b	UTSW	10	68098561	nonsense	probably null
R6525:Arid5b	UTSW	10	68097666	missense	possibly damaging	0.47
R6915:Arid5b	UTSW	10	68186212	nonsense	probably null
R7013:Arid5b	UTSW	10	68097819	missense	probably damaging	1.00
R7099:Arid5b	UTSW	10	68098179	missense	probably damaging	1.00
R7260:Arid5b	UTSW	10	68097807	missense	probably damaging	1.00
R7324:Arid5b	UTSW	10	68128922	missense	probably benign	0.44
R7334:Arid5b	UTSW	10	68243177	missense	possibly damaging	0.61
R7432:Arid5b	UTSW	10	68118266	missense	probably damaging	1.00
R7453:Arid5b	UTSW	10	68243164	missense	probably benign	0.01
R7649:Arid5b	UTSW	10	68118345	missense	possibly damaging	0.92
R7659:Arid5b	UTSW	10	68098587	missense	probably benign
R7661:Arid5b	UTSW	10	68098587	missense	probably benign
R7662:Arid5b	UTSW	10	68098587	missense	probably benign
R7663:Arid5b	UTSW	10	68098587	missense	probably benign
R7665:Arid5b	UTSW	10	68098587	missense	probably benign
R7666:Arid5b	UTSW	10	68098587	missense	probably benign
R7759:Arid5b	UTSW	10	68097802	missense	probably damaging	1.00
R7779:Arid5b	UTSW	10	68096776	missense	probably damaging	1.00
R7788:Arid5b	UTSW	10	68098587	missense	probably benign
R7789:Arid5b	UTSW	10	68098587	missense	probably benign
R7875:Arid5b	UTSW	10	68128941	missense	probably benign	0.02
R8079:Arid5b	UTSW	10	68098356	missense	possibly damaging	0.88
R8096:Arid5b	UTSW	10	68186152	missense	probably benign	0.00
R8228:Arid5b	UTSW	10	68278706	missense	possibly damaging	0.95
R8377:Arid5b	UTSW	10	68097387	missense	probably damaging	0.96
R8757:Arid5b	UTSW	10	68097810	missense	probably damaging	1.00
R8910:Arid5b	UTSW	10	68098278	missense
R8954:Arid5b	UTSW	10	68101980	missense	possibly damaging	0.88
R9234:Arid5b	UTSW	10	68128798	missense	possibly damaging	0.82
R9272:Arid5b	UTSW	10	68102052	missense	probably damaging	0.99
R9430:Arid5b	UTSW	10	68186257	critical splice acceptor site	probably null
X0066:Arid5b	UTSW	10	68118302	missense	probably damaging	1.00
Z1177:Arid5b	UTSW	10	68097228	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTGATAGTAAGGGGTTCCAGGATAATG -3'
(R):5'- GCTTGGCTAAGAATGGATCACTTTTC -3'

Sequencing Primer
(F):5'- TGGACAGAGTGGATGTAGCTCAC -3'
(R):5'- TTTTCCAAACCCAGAATAACATTTTC -3'

Posted On

2016-04-15