Mutagenetix > Incidental Mutations

Incidental Mutation 'R4861:Farp2'

380236

Institutional Source

Beutler Lab

Gene Symbol

Farp2

Ensembl Gene

ENSMUSG00000034066

Gene Name

FERM, RhoGEF and pleckstrin domain protein 2

Synonyms

Fir, D030026M03Rik

MMRRC Submission

042472-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4861 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

93512079-93621976 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 93605419 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 633 (L633S)

Ref Sequence

ENSEMBL: ENSMUSP00000112725 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000120301]

PDB Structure

Crystal strucure of the DH domain of FARP2 [X-RAY DIFFRACTION]
Crystal strucure of the DH-PH-PH domain of FARP2 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000120301
AA Change: L633S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112725
Gene: ENSMUSG00000034066
AA Change: L633S

Domain	Start	End	E-Value	Type
B41	40	234	1.48e-66	SMART
FERM_C	238	328	3.29e-35	SMART
FA	332	378	1.13e-15	SMART
low complexity region	409	421	N/A	INTRINSIC
low complexity region	440	459	N/A	INTRINSIC
low complexity region	462	473	N/A	INTRINSIC
low complexity region	478	492	N/A	INTRINSIC
RhoGEF	542	728	1.57e-56	SMART
PH	759	857	1.45e-19	SMART
low complexity region	879	890	N/A	INTRINSIC
PH	931	1029	2.62e-17	SMART

Meta Mutation Damage Score

0.8212

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 94.2%
20x: 84.7%

Validation Efficiency

100% (53/53)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit slight increase in bone volumetrics and reduced osteoclast differentiation from BMDMs cultured with M-CSF and RANKL [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	C	T	2: 69,245,905	R1153H	probably damaging	Het
Ahcy	T	C	2: 155,060,516	E411G	probably benign	Het
Alpi	T	A	1: 87,100,469	I211F	probably damaging	Het
Arfgef3	G	A	10: 18,607,731	A1415V	probably benign	Het
Car3	T	C	3: 14,866,896	V109A	probably damaging	Het
Ccdc114	A	G	7: 45,942,873	E359G	probably damaging	Het
Cdk13	A	T	13: 17,766,586	V17D	probably damaging	Het
Cept1	A	C	3: 106,505,732	S226A	probably damaging	Het
Dbt	A	T	3: 116,548,078	I443L	probably benign	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Frmd6	T	G	12: 70,893,726	S382A	probably damaging	Het
Gm26727	T	C	2: 67,432,945	I79M	probably damaging	Het
Gm5800	T	A	14: 51,716,047	N37I	probably damaging	Het
Hapln1	G	A	13: 89,601,452	G39S	possibly damaging	Het
Ice2	T	A	9: 69,415,448	S408R	probably benign	Het
Lctl	T	C	9: 64,119,763	I131T	possibly damaging	Het
Mvk	C	T	5: 114,460,197		probably benign	Het
Mzt1	T	C	14: 99,047,474		probably null	Het
Ncoa7	T	A	10: 30,704,612	M117L	probably benign	Het
Npy4r	C	T	14: 34,146,883	W149*	probably null	Het
Nr5a2	A	G	1: 136,948,720		probably null	Het
Plg	G	A	17: 12,395,735	E301K	probably benign	Het
Pnkp	C	T	7: 44,862,403	S113L	probably damaging	Het
Rapgef2	T	C	3: 79,074,436	K1084R	probably benign	Het
Slc41a2	T	C	10: 83,316,458	Q51R	probably damaging	Het
Slc47a2	A	T	11: 61,336,233	C170S	probably benign	Het
Slco1b2	A	T	6: 141,671,222	N427I	possibly damaging	Het
Smc2	G	A	4: 52,461,090	R571H	probably benign	Het
Sp4	G	T	12: 118,300,811		probably null	Het
Tas2r117	T	C	6: 132,803,129	F77L	probably benign	Het
Tbcd	C	T	11: 121,601,961	R875C	probably damaging	Het
Thumpd2	A	G	17: 81,026,801	S453P	probably benign	Het
Vars2	G	T	17: 35,661,933	Q13K	probably benign	Het

Other mutations in Farp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00598:Farp2	APN	1	93603381	missense	probably benign	0.00
IGL00953:Farp2	APN	1	93561174	missense	possibly damaging	0.92
IGL00961:Farp2	APN	1	93621313	missense	possibly damaging	0.81
IGL00970:Farp2	APN	1	93560327	missense	probably benign	0.00
IGL01377:Farp2	APN	1	93603459	missense	possibly damaging	0.74
IGL01408:Farp2	APN	1	93618980	missense	probably benign	0.19
IGL01919:Farp2	APN	1	93576433	missense	probably damaging	1.00
IGL01985:Farp2	APN	1	93607602	missense	probably damaging	1.00
IGL02375:Farp2	APN	1	93576463	missense	probably damaging	1.00
IGL02392:Farp2	APN	1	93577650	missense	probably damaging	1.00
IGL02815:Farp2	APN	1	93560285	missense	probably damaging	1.00
IGL03003:Farp2	APN	1	93567418	missense	probably damaging	1.00
IGL03074:Farp2	APN	1	93560327	missense	probably benign	0.00
IGL03223:Farp2	APN	1	93617602	nonsense	probably null
IGL03379:Farp2	APN	1	93607438	missense	probably benign	0.08
IGL02802:Farp2	UTSW	1	93528610	missense	probably damaging	1.00
PIT4468001:Farp2	UTSW	1	93528777	nonsense	probably null
PIT4494001:Farp2	UTSW	1	93617594	missense	probably damaging	1.00
R0207:Farp2	UTSW	1	93569087	missense	probably damaging	0.96
R0521:Farp2	UTSW	1	93576821	critical splice acceptor site	probably null
R0594:Farp2	UTSW	1	93576500	missense	probably damaging	1.00
R1386:Farp2	UTSW	1	93620151	splice site	probably null
R1522:Farp2	UTSW	1	93618553	missense	possibly damaging	0.79
R1589:Farp2	UTSW	1	93579860	missense	probably damaging	1.00
R1651:Farp2	UTSW	1	93603469	critical splice donor site	probably null
R1695:Farp2	UTSW	1	93560325	missense	probably damaging	0.97
R1833:Farp2	UTSW	1	93576364	splice site	probably benign
R1915:Farp2	UTSW	1	93528702	missense	probably benign	0.16
R2241:Farp2	UTSW	1	93579903	missense	probably benign	0.31
R4505:Farp2	UTSW	1	93619010	missense	probably damaging	1.00
R4518:Farp2	UTSW	1	93620641	missense	probably benign	0.04
R4551:Farp2	UTSW	1	93618592	missense	possibly damaging	0.92
R4723:Farp2	UTSW	1	93580899	missense	probably benign	0.07
R4821:Farp2	UTSW	1	93574470	splice site	probably null
R4861:Farp2	UTSW	1	93605419	missense	probably damaging	1.00
R5221:Farp2	UTSW	1	93576418	missense	probably damaging	0.99
R5625:Farp2	UTSW	1	93528748	missense	probably damaging	1.00
R5663:Farp2	UTSW	1	93570013	missense	probably damaging	1.00
R5935:Farp2	UTSW	1	93620645	critical splice donor site	probably null
R6593:Farp2	UTSW	1	93569940	missense	possibly damaging	0.48
R6853:Farp2	UTSW	1	93570016	missense	probably damaging	1.00
R7001:Farp2	UTSW	1	93620184	missense	possibly damaging	0.94
R7001:Farp2	UTSW	1	93620230	missense	possibly damaging	0.94
R7133:Farp2	UTSW	1	93621234	missense	probably damaging	1.00
R7134:Farp2	UTSW	1	93603459	missense	probably benign	0.04
R7184:Farp2	UTSW	1	93603415	missense	probably damaging	1.00
R7219:Farp2	UTSW	1	93560318	missense	probably damaging	0.97
R7234:Farp2	UTSW	1	93580119	missense	possibly damaging	0.94
R7426:Farp2	UTSW	1	93621228	missense	possibly damaging	0.55
R7477:Farp2	UTSW	1	93581028	splice site	probably null
R7503:Farp2	UTSW	1	93567497	missense	probably benign	0.03
R7921:Farp2	UTSW	1	93567515	critical splice donor site	probably null
R7939:Farp2	UTSW	1	93560261	missense	probably damaging	1.00
R7985:Farp2	UTSW	1	93576524	missense	probably damaging	1.00
R8162:Farp2	UTSW	1	93620603	missense	probably damaging	1.00
R8207:Farp2	UTSW	1	93621243	missense	probably benign	0.00
R8292:Farp2	UTSW	1	93528628	missense	probably damaging	1.00
R8348:Farp2	UTSW	1	93576892	critical splice donor site	probably null
R8495:Farp2	UTSW	1	93603417	missense	possibly damaging	0.74
Z1176:Farp2	UTSW	1	93580136	missense	probably benign
Z1176:Farp2	UTSW	1	93580461	missense	probably benign
Z1176:Farp2	UTSW	1	93580467	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCAAAATCCATCCACGGCTCG -3'
(R):5'- AGTTCGGGTGCATGCTGA -3'

Sequencing Primer
(F):5'- GAGAATCATATCTGAGGCCAGCTC -3'
(R):5'- AGCCGAGAAGCTCTTTGGAG -3'

Posted On

2016-04-15