Incidental Mutation 'R4861:Abcb11'
ID380239
Institutional Source Beutler Lab
Gene Symbol Abcb11
Ensembl Gene ENSMUSG00000027048
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 11
SynonymsPFIC2, Bsep, PGY4, Lith1, ABC16, sister of P-glycoprotein
MMRRC Submission 042472-MU
Accession Numbers

Genbank: NM_021022; MGI: 1351619

Is this an essential gene? Possibly non essential (E-score: 0.494) question?
Stock #R4861 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location69238282-69342616 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 69245905 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 1153 (R1153H)
Ref Sequence ENSEMBL: ENSMUSP00000137017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]
Predicted Effect probably damaging
Transcript: ENSMUST00000102709
AA Change: R1153H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048
AA Change: R1153H

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 373 1.3e-65 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1031 2.7e-55 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102710
AA Change: R1153H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048
AA Change: R1153H

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.7e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 3.2e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126240
Predicted Effect probably damaging
Transcript: ENSMUST00000180142
AA Change: R1153H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048
AA Change: R1153H

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.4e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 2.5e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Meta Mutation Damage Score 0.9195 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.2%
  • 20x: 84.7%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcy T C 2: 155,060,516 E411G probably benign Het
Alpi T A 1: 87,100,469 I211F probably damaging Het
Arfgef3 G A 10: 18,607,731 A1415V probably benign Het
Car3 T C 3: 14,866,896 V109A probably damaging Het
Ccdc114 A G 7: 45,942,873 E359G probably damaging Het
Cdk13 A T 13: 17,766,586 V17D probably damaging Het
Cept1 A C 3: 106,505,732 S226A probably damaging Het
Dbt A T 3: 116,548,078 I443L probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Farp2 T C 1: 93,605,419 L633S probably damaging Het
Frmd6 T G 12: 70,893,726 S382A probably damaging Het
Gm26727 T C 2: 67,432,945 I79M probably damaging Het
Gm5800 T A 14: 51,716,047 N37I probably damaging Het
Hapln1 G A 13: 89,601,452 G39S possibly damaging Het
Ice2 T A 9: 69,415,448 S408R probably benign Het
Lctl T C 9: 64,119,763 I131T possibly damaging Het
Mvk C T 5: 114,460,197 probably benign Het
Mzt1 T C 14: 99,047,474 probably null Het
Ncoa7 T A 10: 30,704,612 M117L probably benign Het
Npy4r C T 14: 34,146,883 W149* probably null Het
Nr5a2 A G 1: 136,948,720 probably null Het
Plg G A 17: 12,395,735 E301K probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Rapgef2 T C 3: 79,074,436 K1084R probably benign Het
Slc41a2 T C 10: 83,316,458 Q51R probably damaging Het
Slc47a2 A T 11: 61,336,233 C170S probably benign Het
Slco1b2 A T 6: 141,671,222 N427I possibly damaging Het
Smc2 G A 4: 52,461,090 R571H probably benign Het
Sp4 G T 12: 118,300,811 probably null Het
Tas2r117 T C 6: 132,803,129 F77L probably benign Het
Tbcd C T 11: 121,601,961 R875C probably damaging Het
Thumpd2 A G 17: 81,026,801 S453P probably benign Het
Vars2 G T 17: 35,661,933 Q13K probably benign Het
Other mutations in Abcb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Abcb11 APN 2 69284681 missense possibly damaging 0.90
IGL01407:Abcb11 APN 2 69245944 missense probably damaging 1.00
IGL01583:Abcb11 APN 2 69296409 missense possibly damaging 0.81
IGL01813:Abcb11 APN 2 69287592 splice site probably benign
IGL01885:Abcb11 APN 2 69287627 missense probably damaging 1.00
IGL01937:Abcb11 APN 2 69287612 missense probably damaging 1.00
IGL02058:Abcb11 APN 2 69243498 missense probably damaging 0.98
IGL02117:Abcb11 APN 2 69323825 splice site probably benign
IGL02119:Abcb11 APN 2 69328000 critical splice acceptor site probably null
IGL02120:Abcb11 APN 2 69257310 missense probably damaging 1.00
IGL02158:Abcb11 APN 2 69299925 missense probably damaging 0.96
IGL02212:Abcb11 APN 2 69248889 missense probably damaging 0.97
IGL02306:Abcb11 APN 2 69265457 nonsense probably null
IGL02505:Abcb11 APN 2 69245761 missense probably damaging 1.00
IGL02538:Abcb11 APN 2 69306605 missense possibly damaging 0.67
IGL02793:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL02863:Abcb11 APN 2 69284682 missense probably damaging 0.99
IGL02875:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL03164:Abcb11 APN 2 69291999 nonsense probably null
IGL03181:Abcb11 APN 2 69328008 intron probably benign
3-1:Abcb11 UTSW 2 69327993 missense probably benign 0.00
FR4737:Abcb11 UTSW 2 69243518 missense probably damaging 0.97
R0031:Abcb11 UTSW 2 69285308 missense probably damaging 1.00
R0398:Abcb11 UTSW 2 69286666 missense probably null 0.82
R0413:Abcb11 UTSW 2 69328011 intron probably benign
R0437:Abcb11 UTSW 2 69257295 missense probably damaging 1.00
R0496:Abcb11 UTSW 2 69277884 splice site probably benign
R0646:Abcb11 UTSW 2 69285283 missense probably damaging 1.00
R0669:Abcb11 UTSW 2 69329318 missense probably benign 0.15
R0856:Abcb11 UTSW 2 69323918 missense probably benign
R1061:Abcb11 UTSW 2 69277809 missense probably benign 0.00
R1460:Abcb11 UTSW 2 69257374 splice site probably benign
R1714:Abcb11 UTSW 2 69306581 missense probably damaging 0.99
R1739:Abcb11 UTSW 2 69261566 missense probably damaging 1.00
R1856:Abcb11 UTSW 2 69245923 missense probably damaging 1.00
R1994:Abcb11 UTSW 2 69282670 splice site probably null
R2086:Abcb11 UTSW 2 69259476 splice site probably benign
R2133:Abcb11 UTSW 2 69323883 missense possibly damaging 0.65
R2516:Abcb11 UTSW 2 69329329 missense possibly damaging 0.88
R2930:Abcb11 UTSW 2 69257358 missense probably damaging 0.96
R3771:Abcb11 UTSW 2 69329376 splice site probably benign
R3772:Abcb11 UTSW 2 69329376 splice site probably benign
R3979:Abcb11 UTSW 2 69323976 missense probably benign 0.11
R4227:Abcb11 UTSW 2 69284776 missense probably damaging 1.00
R4255:Abcb11 UTSW 2 69306605 missense probably benign 0.03
R4614:Abcb11 UTSW 2 69284681 missense possibly damaging 0.90
R4647:Abcb11 UTSW 2 69285271 missense probably damaging 1.00
R4719:Abcb11 UTSW 2 69259627 missense probably damaging 1.00
R4734:Abcb11 UTSW 2 69323962 missense possibly damaging 0.73
R4765:Abcb11 UTSW 2 69245867 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4870:Abcb11 UTSW 2 69239196 missense probably damaging 0.99
R4988:Abcb11 UTSW 2 69323892 missense probably benign 0.12
R5028:Abcb11 UTSW 2 69274012 missense probably damaging 1.00
R5048:Abcb11 UTSW 2 69308506 missense probably benign 0.06
R5177:Abcb11 UTSW 2 69285295 missense probably damaging 1.00
R5301:Abcb11 UTSW 2 69286847 missense probably damaging 0.98
R5789:Abcb11 UTSW 2 69245764 missense probably damaging 1.00
R5892:Abcb11 UTSW 2 69261500 missense probably damaging 0.99
R6003:Abcb11 UTSW 2 69243467 missense probably benign 0.43
R6252:Abcb11 UTSW 2 69291961 missense probably benign 0.10
R6389:Abcb11 UTSW 2 69323894 missense probably damaging 1.00
R6512:Abcb11 UTSW 2 69282652 missense probably benign
R6590:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6690:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6732:Abcb11 UTSW 2 69286846 missense probably damaging 1.00
R6870:Abcb11 UTSW 2 69285298 missense possibly damaging 0.91
R7028:Abcb11 UTSW 2 69265675 missense probably benign
R7223:Abcb11 UTSW 2 69274143 missense probably benign
R7323:Abcb11 UTSW 2 69287635 missense probably damaging 1.00
R7337:Abcb11 UTSW 2 69245769 missense probably damaging 1.00
R7339:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7340:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7341:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7343:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7366:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7393:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7394:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7405:Abcb11 UTSW 2 69287619 missense probably damaging 1.00
R7411:Abcb11 UTSW 2 69303936 critical splice donor site probably null
R7488:Abcb11 UTSW 2 69277802 missense probably benign
R7544:Abcb11 UTSW 2 69265486 missense probably benign 0.05
R7660:Abcb11 UTSW 2 69287594 splice site probably null
R7754:Abcb11 UTSW 2 69286818 missense probably damaging 1.00
R7771:Abcb11 UTSW 2 69239191 missense probably damaging 0.99
R7794:Abcb11 UTSW 2 69286678 missense possibly damaging 0.62
R7834:Abcb11 UTSW 2 69284724 missense probably damaging 1.00
R7842:Abcb11 UTSW 2 69323873 small deletion probably benign
R7894:Abcb11 UTSW 2 69323873 small deletion probably benign
R7897:Abcb11 UTSW 2 69323872 frame shift probably null
R7897:Abcb11 UTSW 2 69323873 small deletion probably benign
R7898:Abcb11 UTSW 2 69323873 small deletion probably benign
R7917:Abcb11 UTSW 2 69284724 missense probably damaging 1.00
R8004:Abcb11 UTSW 2 69257210 missense possibly damaging 0.68
X0058:Abcb11 UTSW 2 69289443 missense probably benign 0.12
X0062:Abcb11 UTSW 2 69245906 missense probably damaging 1.00
X0065:Abcb11 UTSW 2 69299866 missense probably damaging 0.99
Z1176:Abcb11 UTSW 2 69291981 missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69306529 missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69329269 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTAGTATCCCACGCCTCCACAG -3'
(R):5'- CAGTGTGATTGATGTCCCGG -3'

Sequencing Primer
(F):5'- CAGCCCTGTGTTGTTCTGTAAAGAAC -3'
(R):5'- ATTGATGTCCCGGGGCTTTG -3'
Posted On2016-04-15