Incidental Mutation 'R4861:Ahcy'
ID380240
Institutional Source Beutler Lab
Gene Symbol Ahcy
Ensembl Gene ENSMUSG00000027597
Gene NameS-adenosylhomocysteine hydrolase
SynonymsCuBP, SAHH
MMRRC Submission 042472-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4861 (G1)
Quality Score197
Status Validated
Chromosome2
Chromosomal Location155059310-155074497 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155060516 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 411 (E411G)
Ref Sequence ENSEMBL: ENSMUSP00000061851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054607]
Predicted Effect probably benign
Transcript: ENSMUST00000054607
AA Change: E411G

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000061851
Gene: ENSMUSG00000027597
AA Change: E411G

DomainStartEndE-ValueType
AdoHcyase 6 431 N/A SMART
AdoHcyase_NAD 191 352 1.49e-118 SMART
Meta Mutation Damage Score 0.1160 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.2%
  • 20x: 84.7%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. It catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomocysteine (SAH) concentration thought to be important for transmethylation reactions. Deficiency in this protein is one of the different causes of hypermethioninemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: See the ax allele for a deletion that includes the Ahcy gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,245,905 R1153H probably damaging Het
Alpi T A 1: 87,100,469 I211F probably damaging Het
Arfgef3 G A 10: 18,607,731 A1415V probably benign Het
Car3 T C 3: 14,866,896 V109A probably damaging Het
Ccdc114 A G 7: 45,942,873 E359G probably damaging Het
Cdk13 A T 13: 17,766,586 V17D probably damaging Het
Cept1 A C 3: 106,505,732 S226A probably damaging Het
Dbt A T 3: 116,548,078 I443L probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Farp2 T C 1: 93,605,419 L633S probably damaging Het
Frmd6 T G 12: 70,893,726 S382A probably damaging Het
Gm26727 T C 2: 67,432,945 I79M probably damaging Het
Gm5800 T A 14: 51,716,047 N37I probably damaging Het
Hapln1 G A 13: 89,601,452 G39S possibly damaging Het
Ice2 T A 9: 69,415,448 S408R probably benign Het
Lctl T C 9: 64,119,763 I131T possibly damaging Het
Mvk C T 5: 114,460,197 probably benign Het
Mzt1 T C 14: 99,047,474 probably null Het
Ncoa7 T A 10: 30,704,612 M117L probably benign Het
Npy4r C T 14: 34,146,883 W149* probably null Het
Nr5a2 A G 1: 136,948,720 probably null Het
Plg G A 17: 12,395,735 E301K probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Rapgef2 T C 3: 79,074,436 K1084R probably benign Het
Slc41a2 T C 10: 83,316,458 Q51R probably damaging Het
Slc47a2 A T 11: 61,336,233 C170S probably benign Het
Slco1b2 A T 6: 141,671,222 N427I possibly damaging Het
Smc2 G A 4: 52,461,090 R571H probably benign Het
Sp4 G T 12: 118,300,811 probably null Het
Tas2r117 T C 6: 132,803,129 F77L probably benign Het
Tbcd C T 11: 121,601,961 R875C probably damaging Het
Thumpd2 A G 17: 81,026,801 S453P probably benign Het
Vars2 G T 17: 35,661,933 Q13K probably benign Het
Other mutations in Ahcy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Ahcy APN 2 155067361 missense probably benign 0.26
IGL03001:Ahcy APN 2 155064828 missense probably damaging 1.00
F5770:Ahcy UTSW 2 155064921 nonsense probably null
R1226:Ahcy UTSW 2 155064897 missense probably benign 0.01
R1572:Ahcy UTSW 2 155068931 missense probably benign 0.06
R1741:Ahcy UTSW 2 155064234 missense probably benign 0.29
R1879:Ahcy UTSW 2 155064152 critical splice donor site probably null
R1898:Ahcy UTSW 2 155062253 missense probably benign 0.20
R4743:Ahcy UTSW 2 155068968 missense probably damaging 1.00
R4861:Ahcy UTSW 2 155060516 missense probably benign 0.05
R6114:Ahcy UTSW 2 155062159 missense probably damaging 1.00
R7107:Ahcy UTSW 2 155068973 missense probably damaging 0.98
V7582:Ahcy UTSW 2 155064921 nonsense probably null
X0067:Ahcy UTSW 2 155068952 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGCACTGTCCAGGCTACTG -3'
(R):5'- TGACTCTTCTGATGGGGAGC -3'

Sequencing Primer
(F):5'- TCCAGGCTACTGCAAAGTTG -3'
(R):5'- CTCTTCTGATGGGGAGCACTGC -3'
Posted On2016-04-15