Incidental Mutation 'R4861:Mvk'
ID380246
Institutional Source Beutler Lab
Gene Symbol Mvk
Ensembl Gene ENSMUSG00000041939
Gene Namemevalonate kinase
Synonyms2310010A05Rik
MMRRC Submission 042472-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4861 (G1)
Quality Score179
Status Validated
Chromosome5
Chromosomal Location114444269-114460591 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 114460197 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043760] [ENSMUST00000112239] [ENSMUST00000125650] [ENSMUST00000139420]
Predicted Effect probably benign
Transcript: ENSMUST00000043760
SMART Domains Protein: ENSMUSP00000036971
Gene: ENSMUSG00000041939

DomainStartEndE-ValueType
low complexity region 108 118 N/A INTRINSIC
Pfam:GHMP_kinases_N 130 212 7.6e-26 PFAM
Pfam:GHMP_kinases_C 291 365 2.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112239
SMART Domains Protein: ENSMUSP00000107858
Gene: ENSMUSG00000041939

DomainStartEndE-ValueType
low complexity region 120 130 N/A INTRINSIC
Pfam:GHMP_kinases_N 142 224 1.6e-25 PFAM
Pfam:GHMP_kinases_C 303 377 8.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125120
Predicted Effect probably benign
Transcript: ENSMUST00000125650
SMART Domains Protein: ENSMUSP00000114611
Gene: ENSMUSG00000041939

DomainStartEndE-ValueType
low complexity region 120 130 N/A INTRINSIC
Pfam:GHMP_kinases_N 142 224 1.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139420
SMART Domains Protein: ENSMUSP00000142376
Gene: ENSMUSG00000041939

DomainStartEndE-ValueType
PDB:2R42|A 1 62 6e-30 PDB
SCOP:d1kvka1 2 31 1e-10 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.2%
  • 20x: 84.7%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: This gene encodes mevalonate kinase, a key enzyme involved in the biosynthesis of cholesterol and non-sterol isoprenes. The complete lack of encoded protein is lethal to mouse embryos. Mice lacking one allele of this gene exhibit increased levels of mevalonate in spleen, heart and kidney, as well as increased levels of serum immunoglobulins A and D. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,245,905 R1153H probably damaging Het
Ahcy T C 2: 155,060,516 E411G probably benign Het
Alpi T A 1: 87,100,469 I211F probably damaging Het
Arfgef3 G A 10: 18,607,731 A1415V probably benign Het
Car3 T C 3: 14,866,896 V109A probably damaging Het
Ccdc114 A G 7: 45,942,873 E359G probably damaging Het
Cdk13 A T 13: 17,766,586 V17D probably damaging Het
Cept1 A C 3: 106,505,732 S226A probably damaging Het
Dbt A T 3: 116,548,078 I443L probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Farp2 T C 1: 93,605,419 L633S probably damaging Het
Frmd6 T G 12: 70,893,726 S382A probably damaging Het
Gm26727 T C 2: 67,432,945 I79M probably damaging Het
Gm5800 T A 14: 51,716,047 N37I probably damaging Het
Hapln1 G A 13: 89,601,452 G39S possibly damaging Het
Ice2 T A 9: 69,415,448 S408R probably benign Het
Lctl T C 9: 64,119,763 I131T possibly damaging Het
Mzt1 T C 14: 99,047,474 probably null Het
Ncoa7 T A 10: 30,704,612 M117L probably benign Het
Npy4r C T 14: 34,146,883 W149* probably null Het
Nr5a2 A G 1: 136,948,720 probably null Het
Plg G A 17: 12,395,735 E301K probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Rapgef2 T C 3: 79,074,436 K1084R probably benign Het
Slc41a2 T C 10: 83,316,458 Q51R probably damaging Het
Slc47a2 A T 11: 61,336,233 C170S probably benign Het
Slco1b2 A T 6: 141,671,222 N427I possibly damaging Het
Smc2 G A 4: 52,461,090 R571H probably benign Het
Sp4 G T 12: 118,300,811 probably null Het
Tas2r117 T C 6: 132,803,129 F77L probably benign Het
Tbcd C T 11: 121,601,961 R875C probably damaging Het
Thumpd2 A G 17: 81,026,801 S453P probably benign Het
Vars2 G T 17: 35,661,933 Q13K probably benign Het
Other mutations in Mvk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Mvk APN 5 114445441 missense probably benign 0.00
IGL01615:Mvk APN 5 114446292 missense probably benign 0.41
IGL02735:Mvk APN 5 114450819 missense probably benign 0.00
R0206:Mvk UTSW 5 114458974 missense probably damaging 1.00
R1474:Mvk UTSW 5 114460096 missense probably damaging 0.99
R2511:Mvk UTSW 5 114450398 nonsense probably null
R4377:Mvk UTSW 5 114452961 intron probably benign
R4902:Mvk UTSW 5 114455999 missense probably benign 0.05
R5073:Mvk UTSW 5 114452952 intron probably benign
R5355:Mvk UTSW 5 114452438 missense probably damaging 1.00
R5411:Mvk UTSW 5 114458973 missense probably benign 0.00
R5637:Mvk UTSW 5 114455942 missense possibly damaging 0.47
R5687:Mvk UTSW 5 114450765 missense probably damaging 1.00
R6778:Mvk UTSW 5 114452380 missense probably benign 0.01
R7402:Mvk UTSW 5 114455978 missense possibly damaging 0.79
R8305:Mvk UTSW 5 114450779 missense probably damaging 1.00
Z1088:Mvk UTSW 5 114458934 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCCTCAGAAGCCACAAG -3'
(R):5'- CCAGAGAGTTTGTGTGAGGC -3'

Sequencing Primer
(F):5'- ATCCCCCAAGGCTGACTG -3'
(R):5'- ATGTGCCCATAGGAGCTCCAG -3'
Posted On2016-04-15