Incidental Mutation 'R0244:Lipa'
ID38025
Institutional Source Beutler Lab
Gene Symbol Lipa
Ensembl Gene ENSMUSG00000024781
Gene Namelysosomal acid lipase A
SynonymsLal, Lip1, Lip-1
MMRRC Submission 038482-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0244 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location34492318-34527474 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34501541 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 260 (F260I)
Ref Sequence ENSEMBL: ENSMUSP00000136967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049572] [ENSMUST00000178114]
Predicted Effect probably damaging
Transcript: ENSMUST00000049572
AA Change: F260I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000053270
Gene: ENSMUSG00000024781
AA Change: F260I

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 35 97 1.4e-27 PFAM
Pfam:Abhydrolase_5 78 373 2.6e-11 PFAM
Pfam:Abhydrolase_6 80 382 2.2e-10 PFAM
Pfam:Abhydrolase_1 111 388 1e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178114
AA Change: F260I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136967
Gene: ENSMUSG00000024781
AA Change: F260I

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 35 97 1.3e-27 PFAM
Pfam:Abhydrolase_5 78 373 2.5e-11 PFAM
Pfam:Abhydrolase_1 78 379 3.9e-31 PFAM
Meta Mutation Damage Score 0.5343 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes lipase A, the lysosomal acid lipase (also known as cholesterol ester hydrolase). This enzyme functions in the lysosome to catalyze the hydrolysis of cholesteryl esters and triglycerides. Mutations in this gene can result in Wolman disease and cholesteryl ester storage disease. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mice show massive accumulation of triglycerides and cholesteryl esters in several organs, depletion of white and brown fat, hepatosplenomegaly, increased energy intake and plasma free fatty acid levels, insulin resistance, lung inflammation, alveolar destruction and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,286,491 probably null Het
Adamdec1 A T 14: 68,568,723 C434* probably null Het
Adprhl1 A G 8: 13,242,391 probably benign Het
Ago1 T A 4: 126,463,706 I59F possibly damaging Het
Arel1 T C 12: 84,920,693 T786A probably damaging Het
Arhgap26 A G 18: 39,363,131 K117R probably benign Het
Atp6v0b C T 4: 117,884,622 G204D probably damaging Het
Bace2 T A 16: 97,436,773 probably null Het
Camk4 G A 18: 33,179,625 probably null Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cep152 T C 2: 125,564,214 E1466G probably benign Het
Ces3b T C 8: 105,092,635 F441S probably damaging Het
Cfap52 T C 11: 67,926,382 T562A possibly damaging Het
Clca3a2 C A 3: 144,813,898 M238I possibly damaging Het
Cntnap5c A T 17: 58,102,168 D467V probably damaging Het
Col7a1 T A 9: 108,972,184 probably null Het
Cstf1 A G 2: 172,377,710 N247S possibly damaging Het
Dffb G T 4: 153,974,615 N68K probably benign Het
Duox2 C T 2: 122,291,860 G595S probably benign Het
Eftud2 T A 11: 102,864,725 I228F probably damaging Het
Elmo3 T C 8: 105,309,171 V578A probably benign Het
Elp2 A G 18: 24,631,471 D625G possibly damaging Het
Ep300 C T 15: 81,640,128 P1386S unknown Het
Fam120b A G 17: 15,417,637 D610G probably damaging Het
Fastk A T 5: 24,442,178 probably benign Het
Fbxl6 A G 15: 76,537,191 S252P probably damaging Het
Fbxo43 T C 15: 36,161,793 K423E probably damaging Het
Filip1 T A 9: 79,819,462 E625V possibly damaging Het
Fkbp9 T A 6: 56,856,378 Y283* probably null Het
Gigyf2 T A 1: 87,379,015 D142E possibly damaging Het
Gm10142 T C 10: 77,716,014 probably null Het
Golga5 T C 12: 102,476,188 V262A probably benign Het
Hectd4 T C 5: 121,329,605 V2539A probably benign Het
Ica1 G T 6: 8,653,632 S335* probably null Het
Itga1 A T 13: 115,006,897 probably benign Het
Itgb1 T C 8: 128,717,685 probably benign Het
Itpr1 G A 6: 108,473,589 V1960I probably benign Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kprp C T 3: 92,825,411 V111I probably benign Het
Lamc3 T C 2: 31,940,721 I1490T probably damaging Het
Lcp1 A T 14: 75,227,001 D554V possibly damaging Het
Lgi3 A G 14: 70,534,698 T228A probably benign Het
Lrriq1 C T 10: 103,215,773 E373K probably damaging Het
Map6 G A 7: 99,336,836 G649D probably benign Het
Mccc1 A G 3: 35,990,047 probably null Het
Mical3 A T 6: 120,957,722 S1799T probably benign Het
Mmp23 T A 4: 155,652,132 T151S probably damaging Het
Myo1d T A 11: 80,674,708 N401I probably damaging Het
Myo9b T A 8: 71,321,813 S323T probably damaging Het
Nbn G T 4: 15,979,353 W446L probably benign Het
Nedd1 A T 10: 92,716,265 probably benign Het
Ngef C A 1: 87,487,962 probably benign Het
Nup153 A T 13: 46,693,936 N672K probably benign Het
Olfr1308 T C 2: 111,961,016 N19S probably benign Het
Olfr149 T A 9: 39,702,173 I199F probably damaging Het
Olfr1509 T C 14: 52,450,512 V33A probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Palm2 T G 4: 57,710,177 V374G possibly damaging Het
Pdlim3 C A 8: 45,908,460 probably benign Het
Pmfbp1 G A 8: 109,541,673 E951K probably damaging Het
Pop1 T A 15: 34,515,891 C548* probably null Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Ptpdc1 A T 13: 48,585,980 N658K probably benign Het
Ptprk A C 10: 28,206,225 E63D possibly damaging Het
Rtf1 C T 2: 119,732,877 R712W probably damaging Het
Samd7 A C 3: 30,751,073 T2P probably benign Het
Sft2d1 A G 17: 8,319,422 T52A probably benign Het
Slc25a26 A G 6: 94,510,833 H91R probably damaging Het
Slc5a4a A G 10: 76,189,152 E621G possibly damaging Het
Slf1 A T 13: 77,126,632 L28* probably null Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Sorcs2 G A 5: 36,397,553 probably benign Het
Tacc2 T C 7: 130,751,825 probably benign Het
Tas2r140 A G 6: 133,055,327 V156A possibly damaging Het
Terf2ip C A 8: 112,018,164 T371K possibly damaging Het
Tifa C T 3: 127,796,888 L103F probably damaging Het
Tmco3 A G 8: 13,292,037 N104D probably damaging Het
Tmem259 T A 10: 79,978,963 D240V probably damaging Het
Trim60 C T 8: 65,001,048 R183H probably benign Het
Trps1 T C 15: 50,664,743 N725D probably damaging Het
Ttn C T 2: 76,814,806 V12902M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Unc79 A G 12: 103,112,891 K1772E probably damaging Het
Vwde C T 6: 13,193,126 V405I probably benign Het
Wdr18 T A 10: 79,966,408 D290E probably damaging Het
Wdr92 T C 11: 17,229,851 L284P probably damaging Het
Wwc2 G A 8: 47,900,721 A126V probably benign Het
Zfp882 A T 8: 71,913,523 I105F possibly damaging Het
Zfp942 A T 17: 21,928,572 C359S probably benign Het
Other mutations in Lipa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02469:Lipa APN 19 34494035 missense probably damaging 1.00
IGL02517:Lipa APN 19 34494122 missense possibly damaging 0.47
IGL02869:Lipa APN 19 34493997 missense probably benign 0.01
IGL02869:Lipa APN 19 34493971 utr 3 prime probably benign
buckboard UTSW 19 34524746 missense probably benign 0.04
Pashtun UTSW 19 34510928 missense probably damaging 1.00
suri UTSW 19 34501634 nonsense probably null
R0071:Lipa UTSW 19 34495082 missense probably damaging 1.00
R1871:Lipa UTSW 19 34510928 missense probably damaging 1.00
R1929:Lipa UTSW 19 34510890 nonsense probably null
R2189:Lipa UTSW 19 34524799 missense probably benign 0.13
R2270:Lipa UTSW 19 34510890 nonsense probably null
R2271:Lipa UTSW 19 34510890 nonsense probably null
R2272:Lipa UTSW 19 34510890 nonsense probably null
R4737:Lipa UTSW 19 34501634 nonsense probably null
R5713:Lipa UTSW 19 34523432 missense probably benign 0.00
R6381:Lipa UTSW 19 34524746 missense probably benign 0.04
RF012:Lipa UTSW 19 34509098 missense probably damaging 1.00
X0067:Lipa UTSW 19 34509020 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGCAGACAGGACCATTTGCTAAAG -3'
(R):5'- GGAGCCTCTGGATCTTCTCAGAAGTC -3'

Sequencing Primer
(F):5'- CAGGACCATTTGCTAAAGCTGATAC -3'
(R):5'- atccacctgcctctgcc -3'
Posted On2013-05-23