Incidental Mutation 'R4861:Ccdc114'
ID380251
Institutional Source Beutler Lab
Gene Symbol Ccdc114
Ensembl Gene ENSMUSG00000040189
Gene Namecoiled-coil domain containing 114
Synonyms
MMRRC Submission 042472-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4861 (G1)
Quality Score154
Status Validated
Chromosome7
Chromosomal Location45924072-45948963 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45942873 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 359 (E359G)
Ref Sequence ENSEMBL: ENSMUSP00000042772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038720] [ENSMUST00000210867]
Predicted Effect probably damaging
Transcript: ENSMUST00000038720
AA Change: E359G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000042772
Gene: ENSMUSG00000040189
AA Change: E359G

DomainStartEndE-ValueType
coiled coil region 11 94 N/A INTRINSIC
coiled coil region 137 156 N/A INTRINSIC
low complexity region 174 185 N/A INTRINSIC
coiled coil region 195 229 N/A INTRINSIC
coiled coil region 303 380 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 504 519 N/A INTRINSIC
low complexity region 558 588 N/A INTRINSIC
low complexity region 592 604 N/A INTRINSIC
low complexity region 621 656 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210867
Meta Mutation Damage Score 0.1076 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.2%
  • 20x: 84.7%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein that is a component of the outer dynein arm docking complex in cilia cells. Mutations in this gene may cause primary ciliary dyskinesia 20. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,245,905 R1153H probably damaging Het
Ahcy T C 2: 155,060,516 E411G probably benign Het
Alpi T A 1: 87,100,469 I211F probably damaging Het
Arfgef3 G A 10: 18,607,731 A1415V probably benign Het
Car3 T C 3: 14,866,896 V109A probably damaging Het
Cdk13 A T 13: 17,766,586 V17D probably damaging Het
Cept1 A C 3: 106,505,732 S226A probably damaging Het
Dbt A T 3: 116,548,078 I443L probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Farp2 T C 1: 93,605,419 L633S probably damaging Het
Frmd6 T G 12: 70,893,726 S382A probably damaging Het
Gm26727 T C 2: 67,432,945 I79M probably damaging Het
Gm5800 T A 14: 51,716,047 N37I probably damaging Het
Hapln1 G A 13: 89,601,452 G39S possibly damaging Het
Ice2 T A 9: 69,415,448 S408R probably benign Het
Lctl T C 9: 64,119,763 I131T possibly damaging Het
Mvk C T 5: 114,460,197 probably benign Het
Mzt1 T C 14: 99,047,474 probably null Het
Ncoa7 T A 10: 30,704,612 M117L probably benign Het
Npy4r C T 14: 34,146,883 W149* probably null Het
Nr5a2 A G 1: 136,948,720 probably null Het
Plg G A 17: 12,395,735 E301K probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Rapgef2 T C 3: 79,074,436 K1084R probably benign Het
Slc41a2 T C 10: 83,316,458 Q51R probably damaging Het
Slc47a2 A T 11: 61,336,233 C170S probably benign Het
Slco1b2 A T 6: 141,671,222 N427I possibly damaging Het
Smc2 G A 4: 52,461,090 R571H probably benign Het
Sp4 G T 12: 118,300,811 probably null Het
Tas2r117 T C 6: 132,803,129 F77L probably benign Het
Tbcd C T 11: 121,601,961 R875C probably damaging Het
Thumpd2 A G 17: 81,026,801 S453P probably benign Het
Vars2 G T 17: 35,661,933 Q13K probably benign Het
Other mutations in Ccdc114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Ccdc114 APN 7 45942656 missense probably damaging 1.00
IGL01383:Ccdc114 APN 7 45939700 missense probably damaging 1.00
IGL01826:Ccdc114 APN 7 45948386 missense possibly damaging 0.62
R0865:Ccdc114 UTSW 7 45942088 missense probably benign 0.17
R1061:Ccdc114 UTSW 7 45941755 missense probably damaging 0.96
R1217:Ccdc114 UTSW 7 45942758 splice site probably benign
R1533:Ccdc114 UTSW 7 45942858 missense probably benign 0.00
R2863:Ccdc114 UTSW 7 45948312 missense probably benign 0.04
R3954:Ccdc114 UTSW 7 45941676 missense probably damaging 1.00
R4774:Ccdc114 UTSW 7 45948380 missense probably damaging 0.99
R4861:Ccdc114 UTSW 7 45942873 missense probably damaging 0.98
R4952:Ccdc114 UTSW 7 45942191 missense probably damaging 1.00
R5074:Ccdc114 UTSW 7 45929090 missense probably benign 0.05
R5187:Ccdc114 UTSW 7 45929116 missense probably damaging 1.00
R5265:Ccdc114 UTSW 7 45947435 missense probably damaging 1.00
R5364:Ccdc114 UTSW 7 45936332 missense probably damaging 0.99
R5377:Ccdc114 UTSW 7 45942082 nonsense probably null
R6221:Ccdc114 UTSW 7 45947479 missense probably damaging 1.00
R6246:Ccdc114 UTSW 7 45936364 missense probably damaging 1.00
R6324:Ccdc114 UTSW 7 45941710 missense probably damaging 1.00
R6389:Ccdc114 UTSW 7 45948516 missense probably benign 0.32
R6542:Ccdc114 UTSW 7 45948390 missense probably benign 0.00
R6593:Ccdc114 UTSW 7 45947384 missense probably damaging 0.96
R7215:Ccdc114 UTSW 7 45936622 missense probably damaging 1.00
R7401:Ccdc114 UTSW 7 45942765 missense probably damaging 1.00
R7431:Ccdc114 UTSW 7 45929246 missense probably damaging 0.99
R7725:Ccdc114 UTSW 7 45948411 missense probably damaging 0.98
R7878:Ccdc114 UTSW 7 45924560 missense possibly damaging 0.91
R8036:Ccdc114 UTSW 7 45942852 missense probably benign 0.06
X0064:Ccdc114 UTSW 7 45948393 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CGAGATACACCACCTTCAGGAG -3'
(R):5'- GACAGGTGCACCCCAGATG -3'

Sequencing Primer
(F):5'- AGGTGAGCAAGGCCCAC -3'
(R):5'- TGGGCTGACAAAAGACAAGG -3'
Posted On2016-04-15