Mutagenetix > Incidental Mutations

Incidental Mutation 'R4861:Lctl'

380252

Institutional Source

Beutler Lab

Gene Symbol

Lctl

Ensembl Gene

ENSMUSG00000032401

Gene Name

lactase-like

Synonyms

E130104I05Rik, KLPH

MMRRC Submission

042472-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.123) question?

Stock #

R4861 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64117147-64138118 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 64119763 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 131 (I131T)

Ref Sequence

ENSEMBL: ENSMUSP00000120815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034969] [ENSMUST00000118215] [ENSMUST00000124020]

Predicted Effect

probably benign
Transcript: ENSMUST00000034969
AA Change: I131T

PolyPhen 2 Score 0.229 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000034969
Gene: ENSMUSG00000032401
AA Change: I131T

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:Glyco_hydro_1	32	502	1.7e-161	PFAM
transmembrane domain	540	562	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000118215

SMART Domains

Protein: ENSMUSP00000112979
Gene: ENSMUSG00000032401

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_1	1	343	5.8e-99	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124020
AA Change: I131T

PolyPhen 2 Score 0.552 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000120815
Gene: ENSMUSG00000032401
AA Change: I131T

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:Glyco_hydro_1	32	235	2.3e-84	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132018

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139755

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145011

Meta Mutation Damage Score

0.7978

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 94.2%
20x: 84.7%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of family 1 glycosidases. Glycosidases are enzymes that hydrolyze glycosidic bonds and are classified into families based on primary amino acid sequence. Most members of family 1 have two conserved glutamic acid residues, which are required for enzymatic activity. The mouse ortholog of this protein has been characterized and has a domain structure of an N-terminal signal peptide, glycosidase domain, transmembrane domain, and a short cytoplasmic tail. It lacks one of the conserved glutamic acid residues important for catalysis, and its function remains to be determined (PMID: 12084582). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: No notable phenotype was detected in a high-throughput screen of homozygous null mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	C	T	2: 69,245,905	R1153H	probably damaging	Het
Ahcy	T	C	2: 155,060,516	E411G	probably benign	Het
Alpi	T	A	1: 87,100,469	I211F	probably damaging	Het
Arfgef3	G	A	10: 18,607,731	A1415V	probably benign	Het
Car3	T	C	3: 14,866,896	V109A	probably damaging	Het
Ccdc114	A	G	7: 45,942,873	E359G	probably damaging	Het
Cdk13	A	T	13: 17,766,586	V17D	probably damaging	Het
Cept1	A	C	3: 106,505,732	S226A	probably damaging	Het
Dbt	A	T	3: 116,548,078	I443L	probably benign	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Farp2	T	C	1: 93,605,419	L633S	probably damaging	Het
Frmd6	T	G	12: 70,893,726	S382A	probably damaging	Het
Gm26727	T	C	2: 67,432,945	I79M	probably damaging	Het
Gm5800	T	A	14: 51,716,047	N37I	probably damaging	Het
Hapln1	G	A	13: 89,601,452	G39S	possibly damaging	Het
Ice2	T	A	9: 69,415,448	S408R	probably benign	Het
Mvk	C	T	5: 114,460,197		probably benign	Het
Mzt1	T	C	14: 99,047,474		probably null	Het
Ncoa7	T	A	10: 30,704,612	M117L	probably benign	Het
Npy4r	C	T	14: 34,146,883	W149*	probably null	Het
Nr5a2	A	G	1: 136,948,720		probably null	Het
Plg	G	A	17: 12,395,735	E301K	probably benign	Het
Pnkp	C	T	7: 44,862,403	S113L	probably damaging	Het
Rapgef2	T	C	3: 79,074,436	K1084R	probably benign	Het
Slc41a2	T	C	10: 83,316,458	Q51R	probably damaging	Het
Slc47a2	A	T	11: 61,336,233	C170S	probably benign	Het
Slco1b2	A	T	6: 141,671,222	N427I	possibly damaging	Het
Smc2	G	A	4: 52,461,090	R571H	probably benign	Het
Sp4	G	T	12: 118,300,811		probably null	Het
Tas2r117	T	C	6: 132,803,129	F77L	probably benign	Het
Tbcd	C	T	11: 121,601,961	R875C	probably damaging	Het
Thumpd2	A	G	17: 81,026,801	S453P	probably benign	Het
Vars2	G	T	17: 35,661,933	Q13K	probably benign	Het

Other mutations in Lctl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00944:Lctl	APN	9	64133129	nonsense	probably null
IGL03066:Lctl	APN	9	64117735	start codon destroyed	probably null	0.66
IGL03302:Lctl	APN	9	64134848	unclassified	probably benign
R0077:Lctl	UTSW	9	64122107	start codon destroyed	probably null	0.64
R0137:Lctl	UTSW	9	64117698	utr 5 prime	probably benign
R0335:Lctl	UTSW	9	64118887	missense	probably benign	0.00
R0391:Lctl	UTSW	9	64122314	splice site	probably benign
R1740:Lctl	UTSW	9	64133107	missense	probably damaging	1.00
R1866:Lctl	UTSW	9	64131721	missense	probably damaging	1.00
R2160:Lctl	UTSW	9	64117767	missense	probably benign	0.02
R2867:Lctl	UTSW	9	64137868	missense	probably benign	0.23
R2867:Lctl	UTSW	9	64137868	missense	probably benign	0.23
R3605:Lctl	UTSW	9	64133193	missense	probably damaging	1.00
R3607:Lctl	UTSW	9	64133193	missense	probably damaging	1.00
R4585:Lctl	UTSW	9	64131600	missense	probably damaging	1.00
R4861:Lctl	UTSW	9	64119763	missense	possibly damaging	0.55
R5249:Lctl	UTSW	9	64137914	missense	probably benign
R7021:Lctl	UTSW	9	64132793	splice site	probably null
R7106:Lctl	UTSW	9	64132837	missense	probably benign	0.22
R7221:Lctl	UTSW	9	64118935	nonsense	probably null
R7265:Lctl	UTSW	9	64126921	missense	probably damaging	1.00
R7353:Lctl	UTSW	9	64126967	missense	probably damaging	1.00
R7501:Lctl	UTSW	9	64131579	missense	probably benign	0.00
R7615:Lctl	UTSW	9	64122110	missense	probably damaging	1.00
R7855:Lctl	UTSW	9	64133216	missense	possibly damaging	0.89
RF014:Lctl	UTSW	9	64118930	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCAGTGTCAGGCAAGGGTG -3'
(R):5'- TCACCACATCTTTCTGACCAGAG -3'

Sequencing Primer
(F):5'- TGACCAGCCCAGGAGCATG -3'
(R):5'- AGTCAGACTCTAGGCTCTGG -3'

Posted On

2016-04-15