Mutagenetix > Incidental Mutations

Incidental Mutation 'R4861:Ncoa7'

380255

Institutional Source

Beutler Lab

Gene Symbol

Ncoa7

Ensembl Gene

ENSMUSG00000039697

Gene Name

nuclear receptor coactivator 7

Synonyms

9030406N13Rik

MMRRC Submission

042472-MU

Accession Numbers

Genbank: NM_172495; MGI: 2444847

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4861 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30628999-30803326 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 30704612 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 117 (M117L)

Ref Sequence

ENSEMBL: ENSMUSP00000150021 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068567] [ENSMUST00000213836] [ENSMUST00000215725] [ENSMUST00000215740] [ENSMUST00000215926]

Predicted Effect

probably benign
Transcript: ENSMUST00000068567
AA Change: M117L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000066741
Gene: ENSMUSG00000039697
AA Change: M117L

Domain	Start	End	E-Value	Type
coiled coil region	1	32	N/A	INTRINSIC
LysM	118	161	2.24e-7	SMART
low complexity region	165	176	N/A	INTRINSIC
TLDc	781	943	2.86e-64	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000213836
AA Change: M117L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000215725
AA Change: M117L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000215740
AA Change: M117L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000215926
AA Change: M117L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

unknown
Transcript: ENSMUST00000217398
AA Change: M43L

Meta Mutation Damage Score

0.0770

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 94.2%
20x: 84.7%

Validation Efficiency

100% (53/53)

Allele List at MGI

All alleles(108) : Gene trapped(108)

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	C	T	2: 69,245,905	R1153H	probably damaging	Het
Ahcy	T	C	2: 155,060,516	E411G	probably benign	Het
Alpi	T	A	1: 87,100,469	I211F	probably damaging	Het
Arfgef3	G	A	10: 18,607,731	A1415V	probably benign	Het
Car3	T	C	3: 14,866,896	V109A	probably damaging	Het
Ccdc114	A	G	7: 45,942,873	E359G	probably damaging	Het
Cdk13	A	T	13: 17,766,586	V17D	probably damaging	Het
Cept1	A	C	3: 106,505,732	S226A	probably damaging	Het
Dbt	A	T	3: 116,548,078	I443L	probably benign	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Farp2	T	C	1: 93,605,419	L633S	probably damaging	Het
Frmd6	T	G	12: 70,893,726	S382A	probably damaging	Het
Gm26727	T	C	2: 67,432,945	I79M	probably damaging	Het
Gm5800	T	A	14: 51,716,047	N37I	probably damaging	Het
Hapln1	G	A	13: 89,601,452	G39S	possibly damaging	Het
Ice2	T	A	9: 69,415,448	S408R	probably benign	Het
Lctl	T	C	9: 64,119,763	I131T	possibly damaging	Het
Mvk	C	T	5: 114,460,197		probably benign	Het
Mzt1	T	C	14: 99,047,474		probably null	Het
Npy4r	C	T	14: 34,146,883	W149*	probably null	Het
Nr5a2	A	G	1: 136,948,720		probably null	Het
Plg	G	A	17: 12,395,735	E301K	probably benign	Het
Pnkp	C	T	7: 44,862,403	S113L	probably damaging	Het
Rapgef2	T	C	3: 79,074,436	K1084R	probably benign	Het
Slc41a2	T	C	10: 83,316,458	Q51R	probably damaging	Het
Slc47a2	A	T	11: 61,336,233	C170S	probably benign	Het
Slco1b2	A	T	6: 141,671,222	N427I	possibly damaging	Het
Smc2	G	A	4: 52,461,090	R571H	probably benign	Het
Sp4	G	T	12: 118,300,811		probably null	Het
Tas2r117	T	C	6: 132,803,129	F77L	probably benign	Het
Tbcd	C	T	11: 121,601,961	R875C	probably damaging	Het
Thumpd2	A	G	17: 81,026,801	S453P	probably benign	Het
Vars2	G	T	17: 35,661,933	Q13K	probably benign	Het

Other mutations in Ncoa7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01406:Ncoa7	APN	10	30690840	missense	probably damaging	1.00
IGL01716:Ncoa7	APN	10	30662334	missense	probably damaging	0.96
IGL02114:Ncoa7	APN	10	30662364	missense	probably damaging	1.00
IGL02170:Ncoa7	APN	10	30689853	missense	possibly damaging	0.94
IGL02436:Ncoa7	APN	10	30694147	missense	probably damaging	1.00
IGL02499:Ncoa7	APN	10	30690889	missense	probably benign	0.04
IGL02533:Ncoa7	APN	10	30690899	missense	possibly damaging	0.87
IGL02533:Ncoa7	APN	10	30722785	missense	probably damaging	1.00
IGL02590:Ncoa7	APN	10	30694163	missense	probably damaging	1.00
IGL02657:Ncoa7	APN	10	30652976	missense	probably damaging	1.00
IGL03065:Ncoa7	APN	10	30647997	missense	probably damaging	1.00
IGL03088:Ncoa7	APN	10	30698125	splice site	probably null
IGL03090:Ncoa7	APN	10	30662400	missense	probably damaging	0.96
IGL03196:Ncoa7	APN	10	30647514	utr 3 prime	probably benign
D6062:Ncoa7	UTSW	10	30722655	missense	probably damaging	1.00
R0058:Ncoa7	UTSW	10	30647541	missense	probably damaging	1.00
R0058:Ncoa7	UTSW	10	30647541	missense	probably damaging	1.00
R0578:Ncoa7	UTSW	10	30701917	critical splice donor site	probably null
R0729:Ncoa7	UTSW	10	30691579	missense	probably benign	0.00
R1538:Ncoa7	UTSW	10	30694211	missense	probably damaging	0.99
R1539:Ncoa7	UTSW	10	30771729	missense	probably damaging	1.00
R1574:Ncoa7	UTSW	10	30694101	missense	probably damaging	1.00
R1574:Ncoa7	UTSW	10	30694101	missense	probably damaging	1.00
R1624:Ncoa7	UTSW	10	30704659	missense	possibly damaging	0.87
R1639:Ncoa7	UTSW	10	30701992	missense	probably damaging	1.00
R1655:Ncoa7	UTSW	10	30698245	critical splice acceptor site	probably null
R1876:Ncoa7	UTSW	10	30698126	intron	probably benign
R1885:Ncoa7	UTSW	10	30648452	missense	possibly damaging	0.81
R1886:Ncoa7	UTSW	10	30648452	missense	possibly damaging	0.81
R1887:Ncoa7	UTSW	10	30648452	missense	possibly damaging	0.81
R1909:Ncoa7	UTSW	10	30689800	missense	probably damaging	1.00
R1938:Ncoa7	UTSW	10	30698170	missense	probably benign	0.02
R1965:Ncoa7	UTSW	10	30654430	nonsense	probably null
R1978:Ncoa7	UTSW	10	30691299	missense	probably benign
R2303:Ncoa7	UTSW	10	30654435	missense	probably damaging	1.00
R3777:Ncoa7	UTSW	10	30689756	missense	probably damaging	1.00
R3778:Ncoa7	UTSW	10	30689756	missense	probably damaging	1.00
R4026:Ncoa7	UTSW	10	30722724	missense	probably benign	0.02
R4230:Ncoa7	UTSW	10	30698257	splice site	probably null
R4667:Ncoa7	UTSW	10	30690790	missense	probably damaging	1.00
R4786:Ncoa7	UTSW	10	30655642	missense	probably benign	0.28
R4809:Ncoa7	UTSW	10	30771762	missense	possibly damaging	0.92
R4820:Ncoa7	UTSW	10	30648476	missense	probably damaging	1.00
R4839:Ncoa7	UTSW	10	30722659	missense	possibly damaging	0.93
R4861:Ncoa7	UTSW	10	30704612	missense	probably benign
R5271:Ncoa7	UTSW	10	30722729	missense	probably benign	0.02
R5384:Ncoa7	UTSW	10	30722817	missense	probably benign	0.00
R5418:Ncoa7	UTSW	10	30648039	missense	probably damaging	1.00
R5964:Ncoa7	UTSW	10	30704636	missense	probably damaging	1.00
R6257:Ncoa7	UTSW	10	30694177	missense	probably damaging	1.00
R6683:Ncoa7	UTSW	10	30771721	missense	probably damaging	0.99
R6813:Ncoa7	UTSW	10	30696192	missense	probably damaging	1.00
R6910:Ncoa7	UTSW	10	30694121	missense	possibly damaging	0.89
R7123:Ncoa7	UTSW	10	30654439	missense	probably benign	0.28
R7327:Ncoa7	UTSW	10	30689800	missense	probably damaging	1.00
R7412:Ncoa7	UTSW	10	30722851	missense	possibly damaging	0.94
R7638:Ncoa7	UTSW	10	30722798	missense	probably benign	0.35
R7653:Ncoa7	UTSW	10	30694243	missense	probably damaging	1.00
R7848:Ncoa7	UTSW	10	30648418	missense	possibly damaging	0.82
R7861:Ncoa7	UTSW	10	30691060	missense	probably benign	0.38
R8125:Ncoa7	UTSW	10	30694091	missense	possibly damaging	0.80
R8198:Ncoa7	UTSW	10	30704668	missense	probably benign	0.00
R8240:Ncoa7	UTSW	10	30691729	missense	probably benign	0.45
R8509:Ncoa7	UTSW	10	30696052	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCTTTCCACATAAAACAAAGGGA -3'
(R):5'- GCGTGTGTTCCATTTCTACC -3'

Sequencing Primer
(F):5'- GAAAAAGACATGACCTAAAATGTGTC -3'
(R):5'- GCGTGTGTTCCATTTCTACCCATTG -3'

Posted On

2016-04-15