Incidental Mutation 'R4861:Slc41a2'
ID380256
Institutional Source Beutler Lab
Gene Symbol Slc41a2
Ensembl Gene ENSMUSG00000034591
Gene Namesolute carrier family 41, member 2
SynonymsA230035L05Rik
MMRRC Submission 042472-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R4861 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location83230848-83337882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83316458 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 51 (Q51R)
Ref Sequence ENSEMBL: ENSMUSP00000116482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039956] [ENSMUST00000126617] [ENSMUST00000154730] [ENSMUST00000154926]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039956
AA Change: Q51R

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036690
Gene: ENSMUSG00000034591
AA Change: Q51R

DomainStartEndE-ValueType
transmembrane domain 159 181 N/A INTRINSIC
Pfam:MgtE 200 334 8.7e-24 PFAM
transmembrane domain 346 368 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
Pfam:MgtE 414 557 2.9e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126617
AA Change: Q51R

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000154730
Predicted Effect probably damaging
Transcript: ENSMUST00000154926
AA Change: Q51R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.0900 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.2%
  • 20x: 84.7%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,245,905 R1153H probably damaging Het
Ahcy T C 2: 155,060,516 E411G probably benign Het
Alpi T A 1: 87,100,469 I211F probably damaging Het
Arfgef3 G A 10: 18,607,731 A1415V probably benign Het
Car3 T C 3: 14,866,896 V109A probably damaging Het
Ccdc114 A G 7: 45,942,873 E359G probably damaging Het
Cdk13 A T 13: 17,766,586 V17D probably damaging Het
Cept1 A C 3: 106,505,732 S226A probably damaging Het
Dbt A T 3: 116,548,078 I443L probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Farp2 T C 1: 93,605,419 L633S probably damaging Het
Frmd6 T G 12: 70,893,726 S382A probably damaging Het
Gm26727 T C 2: 67,432,945 I79M probably damaging Het
Gm5800 T A 14: 51,716,047 N37I probably damaging Het
Hapln1 G A 13: 89,601,452 G39S possibly damaging Het
Ice2 T A 9: 69,415,448 S408R probably benign Het
Lctl T C 9: 64,119,763 I131T possibly damaging Het
Mvk C T 5: 114,460,197 probably benign Het
Mzt1 T C 14: 99,047,474 probably null Het
Ncoa7 T A 10: 30,704,612 M117L probably benign Het
Npy4r C T 14: 34,146,883 W149* probably null Het
Nr5a2 A G 1: 136,948,720 probably null Het
Plg G A 17: 12,395,735 E301K probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Rapgef2 T C 3: 79,074,436 K1084R probably benign Het
Slc47a2 A T 11: 61,336,233 C170S probably benign Het
Slco1b2 A T 6: 141,671,222 N427I possibly damaging Het
Smc2 G A 4: 52,461,090 R571H probably benign Het
Sp4 G T 12: 118,300,811 probably null Het
Tas2r117 T C 6: 132,803,129 F77L probably benign Het
Tbcd C T 11: 121,601,961 R875C probably damaging Het
Thumpd2 A G 17: 81,026,801 S453P probably benign Het
Vars2 G T 17: 35,661,933 Q13K probably benign Het
Other mutations in Slc41a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Slc41a2 APN 10 83313530 unclassified probably benign
IGL02263:Slc41a2 APN 10 83313500 missense possibly damaging 0.82
IGL02338:Slc41a2 APN 10 83316591 missense possibly damaging 0.68
IGL02680:Slc41a2 APN 10 83283864 missense probably benign 0.20
IGL02703:Slc41a2 APN 10 83254847 missense probably damaging 1.00
IGL03039:Slc41a2 APN 10 83283858 missense probably benign 0.37
PIT4508001:Slc41a2 UTSW 10 83254880 missense probably damaging 0.99
R0326:Slc41a2 UTSW 10 83283746 missense probably damaging 1.00
R0470:Slc41a2 UTSW 10 83316222 missense possibly damaging 0.94
R0610:Slc41a2 UTSW 10 83283728 missense possibly damaging 0.75
R1708:Slc41a2 UTSW 10 83233732 missense probably damaging 1.00
R1765:Slc41a2 UTSW 10 83301266 missense probably damaging 1.00
R1870:Slc41a2 UTSW 10 83301165 nonsense probably null
R1875:Slc41a2 UTSW 10 83256085 missense probably damaging 1.00
R2008:Slc41a2 UTSW 10 83304303 critical splice donor site probably null
R2172:Slc41a2 UTSW 10 83283774 missense probably benign 0.00
R4193:Slc41a2 UTSW 10 83301221 missense probably damaging 0.97
R4789:Slc41a2 UTSW 10 83316456 missense probably damaging 1.00
R4861:Slc41a2 UTSW 10 83316458 missense probably damaging 0.99
R4913:Slc41a2 UTSW 10 83313420 missense probably damaging 1.00
R5012:Slc41a2 UTSW 10 83301263 missense probably benign 0.02
R5140:Slc41a2 UTSW 10 83297291 missense probably damaging 0.98
R5189:Slc41a2 UTSW 10 83313411 splice site probably null
R5410:Slc41a2 UTSW 10 83281368 critical splice donor site probably null
R5748:Slc41a2 UTSW 10 83297159 missense probably benign 0.00
R5808:Slc41a2 UTSW 10 83313498 missense probably benign 0.29
R6124:Slc41a2 UTSW 10 83297252 missense probably damaging 1.00
R6292:Slc41a2 UTSW 10 83254926 missense probably damaging 0.99
R6511:Slc41a2 UTSW 10 83283788 missense probably damaging 0.99
R6793:Slc41a2 UTSW 10 83301158 splice site probably null
R6970:Slc41a2 UTSW 10 83316096 missense possibly damaging 0.53
R7584:Slc41a2 UTSW 10 83316789 splice site probably benign
R7752:Slc41a2 UTSW 10 83256041 missense possibly damaging 0.73
R8289:Slc41a2 UTSW 10 83301180 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CGTCACAGTAGTTATAGCCAGC -3'
(R):5'- GCTTGGGTCTGAAGGATACAGG -3'

Sequencing Primer
(F):5'- AGCCAGCATAGTCATCGTACTTGG -3'
(R):5'- AAGGATACAGGTCTTTTTGTGATGAC -3'
Posted On2016-04-15