Incidental Mutation 'R4861:Cdk13'
ID380261
Institutional Source Beutler Lab
Gene Symbol Cdk13
Ensembl Gene ENSMUSG00000041297
Gene Namecyclin-dependent kinase 13
Synonyms2310015O17Rik, Cdc2l5
MMRRC Submission 042472-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4861 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location17710315-17805097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 17766586 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 17 (V17D)
Ref Sequence ENSEMBL: ENSMUSP00000152539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042365] [ENSMUST00000222800] [ENSMUST00000223490]
Predicted Effect probably damaging
Transcript: ENSMUST00000042365
AA Change: V631D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000036013
Gene: ENSMUSG00000041297
AA Change: V631D

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 32 86 N/A INTRINSIC
low complexity region 93 113 N/A INTRINSIC
low complexity region 130 139 N/A INTRINSIC
low complexity region 160 187 N/A INTRINSIC
low complexity region 189 225 N/A INTRINSIC
low complexity region 238 272 N/A INTRINSIC
low complexity region 337 377 N/A INTRINSIC
low complexity region 384 402 N/A INTRINSIC
low complexity region 405 442 N/A INTRINSIC
low complexity region 450 490 N/A INTRINSIC
internal_repeat_1 553 599 6.15e-5 PROSPERO
low complexity region 607 617 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 645 661 N/A INTRINSIC
S_TKc 705 998 7.25e-94 SMART
low complexity region 1173 1184 N/A INTRINSIC
internal_repeat_1 1190 1236 6.15e-5 PROSPERO
low complexity region 1248 1273 N/A INTRINSIC
low complexity region 1299 1311 N/A INTRINSIC
low complexity region 1355 1360 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000222800
AA Change: V17D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222848
Predicted Effect probably damaging
Transcript: ENSMUST00000223490
AA Change: V631D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.2%
  • 20x: 84.7%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the cyclin-dependent serine/threonine protein kinase family. Members of this family are well known for their essential roles as master switches in cell cycle control. The exact function of this protein has not yet been determined, but it may play a role in mRNA processing and may be involved in regulation of hematopoiesis. Alternatively spliced transcript variants have been described.[provided by RefSeq, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,245,905 R1153H probably damaging Het
Ahcy T C 2: 155,060,516 E411G probably benign Het
Alpi T A 1: 87,100,469 I211F probably damaging Het
Arfgef3 G A 10: 18,607,731 A1415V probably benign Het
Car3 T C 3: 14,866,896 V109A probably damaging Het
Ccdc114 A G 7: 45,942,873 E359G probably damaging Het
Cept1 A C 3: 106,505,732 S226A probably damaging Het
Dbt A T 3: 116,548,078 I443L probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Farp2 T C 1: 93,605,419 L633S probably damaging Het
Frmd6 T G 12: 70,893,726 S382A probably damaging Het
Gm26727 T C 2: 67,432,945 I79M probably damaging Het
Gm5800 T A 14: 51,716,047 N37I probably damaging Het
Hapln1 G A 13: 89,601,452 G39S possibly damaging Het
Ice2 T A 9: 69,415,448 S408R probably benign Het
Lctl T C 9: 64,119,763 I131T possibly damaging Het
Mvk C T 5: 114,460,197 probably benign Het
Mzt1 T C 14: 99,047,474 probably null Het
Ncoa7 T A 10: 30,704,612 M117L probably benign Het
Npy4r C T 14: 34,146,883 W149* probably null Het
Nr5a2 A G 1: 136,948,720 probably null Het
Plg G A 17: 12,395,735 E301K probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Rapgef2 T C 3: 79,074,436 K1084R probably benign Het
Slc41a2 T C 10: 83,316,458 Q51R probably damaging Het
Slc47a2 A T 11: 61,336,233 C170S probably benign Het
Slco1b2 A T 6: 141,671,222 N427I possibly damaging Het
Smc2 G A 4: 52,461,090 R571H probably benign Het
Sp4 G T 12: 118,300,811 probably null Het
Tas2r117 T C 6: 132,803,129 F77L probably benign Het
Tbcd C T 11: 121,601,961 R875C probably damaging Het
Thumpd2 A G 17: 81,026,801 S453P probably benign Het
Vars2 G T 17: 35,661,933 Q13K probably benign Het
Other mutations in Cdk13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Cdk13 APN 13 17721098 missense possibly damaging 0.88
IGL00800:Cdk13 APN 13 17728142 missense probably damaging 1.00
IGL02186:Cdk13 APN 13 17772527 missense probably benign 0.02
IGL02447:Cdk13 APN 13 17772416 missense probably benign 0.10
IGL02494:Cdk13 APN 13 17739125 nonsense probably null
IGL02542:Cdk13 APN 13 17728178 missense probably damaging 0.99
IGL02602:Cdk13 APN 13 17727160 missense probably damaging 0.99
Vortex UTSW 13 17739154 missense probably damaging 1.00
Whirlpool UTSW 13 17772403 missense possibly damaging 0.92
R0115:Cdk13 UTSW 13 17719494 missense probably damaging 0.99
R0421:Cdk13 UTSW 13 17763170 missense probably damaging 0.99
R0481:Cdk13 UTSW 13 17719494 missense probably damaging 0.99
R0681:Cdk13 UTSW 13 17721297 splice site probably benign
R1432:Cdk13 UTSW 13 17718416 missense probably damaging 1.00
R2013:Cdk13 UTSW 13 17739163 nonsense probably null
R2221:Cdk13 UTSW 13 17719535 missense probably damaging 0.99
R2332:Cdk13 UTSW 13 17718695 missense probably damaging 1.00
R2389:Cdk13 UTSW 13 17751776 missense probably damaging 1.00
R4546:Cdk13 UTSW 13 17766574 missense probably damaging 0.98
R4753:Cdk13 UTSW 13 17763248 missense probably damaging 1.00
R4855:Cdk13 UTSW 13 17721283 missense probably damaging 1.00
R4856:Cdk13 UTSW 13 17719734 missense probably benign
R4861:Cdk13 UTSW 13 17766586 missense probably damaging 1.00
R4886:Cdk13 UTSW 13 17719734 missense probably benign
R4909:Cdk13 UTSW 13 17772403 missense possibly damaging 0.92
R5152:Cdk13 UTSW 13 17718525 missense probably benign 0.13
R5308:Cdk13 UTSW 13 17772313 missense probably damaging 0.98
R5350:Cdk13 UTSW 13 17803930 unclassified probably benign
R5412:Cdk13 UTSW 13 17766530 missense probably damaging 1.00
R5493:Cdk13 UTSW 13 17803562 unclassified probably benign
R5719:Cdk13 UTSW 13 17719655 missense probably damaging 0.98
R6052:Cdk13 UTSW 13 17721215 missense probably damaging 1.00
R6349:Cdk13 UTSW 13 17751719 missense probably damaging 1.00
R6415:Cdk13 UTSW 13 17739154 missense probably damaging 1.00
R7665:Cdk13 UTSW 13 17772553 missense possibly damaging 0.78
R7666:Cdk13 UTSW 13 17772576 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TTTGTTTCAGAACTCTAAACCAACC -3'
(R):5'- TTCGTGGTTGAAGGATAATAATCTG -3'

Sequencing Primer
(F):5'- AGTGTGTCCAGTCAACCTAAGTGC -3'
(R):5'- CTGTTTAGATGGACTTGAAGTATGAC -3'
Posted On2016-04-15