Incidental Mutation 'R4935:Knl1'
ID380278
Institutional Source Beutler Lab
Gene Symbol Knl1
Ensembl Gene ENSMUSG00000027326
Gene Namekinetochore scaffold 1
Synonyms2310043D08Rik, 5730505K17Rik
MMRRC Submission 042535-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4935 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location119047119-119105501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119068957 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 380 (I380V)
Ref Sequence ENSEMBL: ENSMUSP00000028799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028799] [ENSMUST00000028802] [ENSMUST00000099542] [ENSMUST00000152380] [ENSMUST00000153300]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028799
AA Change: I380V

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028799
Gene: ENSMUSG00000027326
AA Change: I380V

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
PDB:4A1G|H 126 175 1e-13 PDB
low complexity region 426 433 N/A INTRINSIC
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028802
AA Change: I380V

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: I380V

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000099542
AA Change: I380V

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: I380V

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000152380
AA Change: I380V

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000118646
Gene: ENSMUSG00000027326
AA Change: I380V

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
PDB:4A1G|H 126 175 3e-14 PDB
low complexity region 426 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153300
SMART Domains Protein: ENSMUSP00000120905
Gene: ENSMUSG00000027326

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 86.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730071L15Rik A G 11: 6,200,442 *138W probably null Het
Abcb1a T A 5: 8,737,773 probably null Het
Acp6 T C 3: 97,171,744 probably null Het
Adcyap1 A T 17: 93,204,113 I172L probably benign Het
Adgrf1 A C 17: 43,295,239 I85L probably benign Het
Afdn A T 17: 13,890,966 T1604S probably benign Het
Angpt2 T C 8: 18,692,115 Y475C probably damaging Het
Ank2 A G 3: 126,956,064 S439P probably damaging Het
Ank3 T A 10: 69,976,203 N366K probably damaging Het
Ankrd11 A G 8: 122,900,183 S87P probably benign Het
Ano7 T A 1: 93,395,314 S459T possibly damaging Het
Asxl3 G A 18: 22,523,312 V1460M probably benign Het
Atg16l1 A C 1: 87,767,042 N147T possibly damaging Het
Atp10a T C 7: 58,813,764 V1015A probably damaging Het
Atxn7 T A 14: 14,100,401 S696T probably benign Het
Babam1 C T 8: 71,399,802 T184I probably benign Het
Blk A G 14: 63,381,262 S175P possibly damaging Het
Col5a1 T A 2: 28,024,742 F123L probably damaging Het
Csmd3 T C 15: 48,161,084 Y496C probably damaging Het
Dnah3 A T 7: 120,016,477 Y1676* probably null Het
Fdxacb1 T A 9: 50,771,943 M402K probably benign Het
Frmd5 A G 2: 121,562,924 V141A possibly damaging Het
Gapvd1 G A 2: 34,704,492 R685* probably null Het
Grik2 A G 10: 49,240,730 L645P probably damaging Het
H2afj T A 6: 136,808,683 V115E possibly damaging Het
Hrh3 T C 2: 180,101,268 Y189C probably damaging Het
Kcnc2 A G 10: 112,272,228 T175A probably benign Het
Kcnv2 A G 19: 27,322,932 Y61C probably damaging Het
Kif24 T C 4: 41,394,939 R645G probably damaging Het
Lamb2 A G 9: 108,487,501 I1151M possibly damaging Het
Leo1 A G 9: 75,445,877 D234G probably benign Het
Lrp1b T G 2: 41,498,393 N407H probably benign Het
Matn2 T C 15: 34,428,685 S732P probably damaging Het
Mrps30 A T 13: 118,386,895 F114I possibly damaging Het
Olfr1293-ps G A 2: 111,527,448 V45I probably damaging Het
Olfr1487 T C 19: 13,619,702 I180T probably benign Het
Olfr355 T C 2: 36,927,701 N138D probably benign Het
Oxr1 T C 15: 41,813,584 V179A probably benign Het
Plaur A T 7: 24,466,716 S71C possibly damaging Het
Plbd2 T C 5: 120,486,721 N461D possibly damaging Het
Plcb2 T A 2: 118,718,915 Y322F probably damaging Het
Prkab2 T C 3: 97,662,355 V79A probably damaging Het
Ptpn3 A T 4: 57,197,568 C774S probably damaging Het
Ring1 A C 17: 34,023,042 L131R probably benign Het
Rxfp2 G A 5: 150,051,632 probably null Het
Selenbp1 A T 3: 94,937,958 I122F probably benign Het
Sept7 A G 9: 25,306,172 H394R probably benign Het
Slc1a7 G A 4: 108,007,561 V266I probably damaging Het
Slc2a10 A G 2: 165,517,658 T481A probably benign Het
Tapbp A G 17: 33,925,622 M231V probably benign Het
Tbxas1 A T 6: 39,023,047 N256I probably benign Het
Thegl T C 5: 77,037,353 probably null Het
Uimc1 A G 13: 55,093,185 I30T probably damaging Het
Usp48 C A 4: 137,650,358 N231K probably benign Het
Zfhx3 T G 8: 108,947,850 V1844G possibly damaging Het
Znrf3 A T 11: 5,283,422 C212S probably damaging Het
Other mutations in Knl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Knl1 APN 2 119064083 missense probably damaging 0.96
IGL00582:Knl1 APN 2 119102499 missense probably benign 0.19
IGL00666:Knl1 APN 2 119070464 missense probably damaging 0.96
IGL01062:Knl1 APN 2 119076980 missense probably benign 0.33
IGL01395:Knl1 APN 2 119071566 missense probably damaging 0.96
IGL01604:Knl1 APN 2 119070001 missense probably damaging 1.00
IGL01996:Knl1 APN 2 119104061 missense probably damaging 1.00
IGL02086:Knl1 APN 2 119100774 missense probably benign 0.40
IGL02105:Knl1 APN 2 119071808 missense probably benign
IGL02106:Knl1 APN 2 119072008 missense possibly damaging 0.89
IGL02201:Knl1 APN 2 119069152 missense probably benign 0.01
IGL02252:Knl1 APN 2 119072540 missense probably damaging 1.00
IGL02414:Knl1 APN 2 119070323 missense possibly damaging 0.83
IGL02655:Knl1 APN 2 119070992 missense possibly damaging 0.62
IGL02682:Knl1 APN 2 119077969 missense possibly damaging 0.86
IGL02710:Knl1 APN 2 119070930 missense probably damaging 0.99
IGL02877:Knl1 APN 2 119088831 missense probably benign 0.08
IGL03100:Knl1 APN 2 119100770 missense probably damaging 0.99
IGL03210:Knl1 APN 2 119070617 missense probably benign 0.02
IGL03138:Knl1 UTSW 2 119072359 missense probably damaging 0.96
R0023:Knl1 UTSW 2 119102549 missense possibly damaging 0.73
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0078:Knl1 UTSW 2 119069892 missense probably benign 0.16
R0178:Knl1 UTSW 2 119058405 splice site probably benign
R0295:Knl1 UTSW 2 119088839 missense probably damaging 1.00
R0433:Knl1 UTSW 2 119104061 missense probably damaging 0.96
R0453:Knl1 UTSW 2 119068388 missense probably damaging 1.00
R0569:Knl1 UTSW 2 119097435 missense possibly damaging 0.95
R0827:Knl1 UTSW 2 119088901 splice site probably benign
R0920:Knl1 UTSW 2 119069828 missense probably benign 0.00
R1120:Knl1 UTSW 2 119062375 missense probably damaging 0.99
R1155:Knl1 UTSW 2 119071154 missense possibly damaging 0.90
R1204:Knl1 UTSW 2 119071189 missense probably benign 0.00
R1241:Knl1 UTSW 2 119072573 missense probably benign 0.03
R1387:Knl1 UTSW 2 119070730 missense possibly damaging 0.93
R1448:Knl1 UTSW 2 119068307 missense probably damaging 1.00
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1719:Knl1 UTSW 2 119071738 missense probably benign 0.01
R1721:Knl1 UTSW 2 119076334 missense probably damaging 1.00
R2128:Knl1 UTSW 2 119071819 missense possibly damaging 0.79
R2170:Knl1 UTSW 2 119087594 critical splice donor site probably null
R2227:Knl1 UTSW 2 119072000 missense probably damaging 0.97
R2246:Knl1 UTSW 2 119072227 missense probably damaging 1.00
R2275:Knl1 UTSW 2 119072281 missense probably damaging 0.99
R2508:Knl1 UTSW 2 119058368 nonsense probably null
R3115:Knl1 UTSW 2 119070391 missense possibly damaging 0.53
R3122:Knl1 UTSW 2 119068944 missense probably benign 0.32
R3431:Knl1 UTSW 2 119062362 missense probably damaging 1.00
R3755:Knl1 UTSW 2 119102579 missense probably damaging 1.00
R4461:Knl1 UTSW 2 119059599 missense probably benign 0.00
R4600:Knl1 UTSW 2 119070544 missense possibly damaging 0.90
R4713:Knl1 UTSW 2 119069137 nonsense probably null
R4758:Knl1 UTSW 2 119071732 frame shift probably null
R4762:Knl1 UTSW 2 119071936 missense probably benign 0.01
R4869:Knl1 UTSW 2 119072351 missense possibly damaging 0.73
R4870:Knl1 UTSW 2 119081513 missense probably benign 0.22
R5167:Knl1 UTSW 2 119070031 missense probably damaging 1.00
R5184:Knl1 UTSW 2 119069176 missense probably damaging 1.00
R5293:Knl1 UTSW 2 119069695 missense probably damaging 0.99
R5326:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5331:Knl1 UTSW 2 119070255 missense possibly damaging 0.92
R5353:Knl1 UTSW 2 119070983 missense probably benign 0.01
R5493:Knl1 UTSW 2 119068730 missense probably damaging 0.98
R5542:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5632:Knl1 UTSW 2 119070352 missense probably damaging 1.00
R5650:Knl1 UTSW 2 119081550 nonsense probably null
R5854:Knl1 UTSW 2 119070403 missense probably benign 0.02
R5979:Knl1 UTSW 2 119069360 missense possibly damaging 0.83
R6086:Knl1 UTSW 2 119094068 missense probably damaging 1.00
R6283:Knl1 UTSW 2 119070286 missense probably damaging 1.00
R6285:Knl1 UTSW 2 119071941 missense probably damaging 1.00
R6313:Knl1 UTSW 2 119069318 missense probably damaging 1.00
R6419:Knl1 UTSW 2 119069003 missense probably benign 0.02
R6608:Knl1 UTSW 2 119086612 missense probably damaging 0.99
R6881:Knl1 UTSW 2 119095184 missense possibly damaging 0.67
R7161:Knl1 UTSW 2 119070785 missense possibly damaging 0.79
R7206:Knl1 UTSW 2 119069299 missense probably benign 0.35
R7270:Knl1 UTSW 2 119102522 missense possibly damaging 0.53
R7276:Knl1 UTSW 2 119071686 missense probably damaging 0.98
R7358:Knl1 UTSW 2 119070559 missense possibly damaging 0.92
R7402:Knl1 UTSW 2 119095226 nonsense probably null
R7408:Knl1 UTSW 2 119070592 missense possibly damaging 0.54
R7475:Knl1 UTSW 2 119087546 missense probably damaging 1.00
R7516:Knl1 UTSW 2 119070698 missense probably damaging 0.99
R7524:Knl1 UTSW 2 119065979 missense probably damaging 1.00
R7559:Knl1 UTSW 2 119094006 missense possibly damaging 0.84
R7607:Knl1 UTSW 2 119095133 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCAATGAGTGTATGGAGTTGACAAC -3'
(R):5'- GAATACTTATCATCAGCCTTCAGC -3'

Sequencing Primer
(F):5'- CTATACGATACAGGTTTTGTCATCAG -3'
(R):5'- TACCCCTCAATAGCTGGA -3'
Posted On2016-04-15