Incidental Mutation 'R4935:Hrh3'
ID380281
Institutional Source Beutler Lab
Gene Symbol Hrh3
Ensembl Gene ENSMUSG00000039059
Gene Namehistamine receptor H3
Synonyms
MMRRC Submission 042535-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R4935 (G1)
Quality Score224
Status Not validated
Chromosome2
Chromosomal Location180099465-180104488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 180101268 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 189 (Y189C)
Ref Sequence ENSEMBL: ENSMUSP00000127085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056480] [ENSMUST00000163215] [ENSMUST00000164442] [ENSMUST00000165248] [ENSMUST00000165762] [ENSMUST00000166724] [ENSMUST00000171736]
Predicted Effect probably damaging
Transcript: ENSMUST00000056480
AA Change: Y189C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049963
Gene: ENSMUSG00000039059
AA Change: Y189C

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 412 7.2e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163215
AA Change: Y189C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127053
Gene: ENSMUSG00000039059
AA Change: Y189C

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 376 2e-55 PFAM
low complexity region 406 415 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164442
AA Change: Y189C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130553
Gene: ENSMUSG00000039059
AA Change: Y189C

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 380 4.8e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165248
AA Change: Y189C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130181
Gene: ENSMUSG00000039059
AA Change: Y189C

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 364 6.9e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165762
AA Change: Y189C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132203
Gene: ENSMUSG00000039059
AA Change: Y189C

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 412 1.3e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166392
Predicted Effect probably benign
Transcript: ENSMUST00000166724
SMART Domains Protein: ENSMUSP00000126336
Gene: ENSMUSG00000039059

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 93 1.8e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171736
AA Change: Y189C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127085
Gene: ENSMUSG00000039059
AA Change: Y189C

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 239 5.2e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172211
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 86.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histamine is a ubiquitous messenger molecule released from mast cells, enterochromaffin-like cells, and neurons. Its various actions are mediated by histamine receptors H1, H2, H3 and H4. This gene encodes one of the histamine receptors (H3) which belongs to the family 1 of G protein-coupled receptors. It is an integral membrane protein and can regulate neurotransmitter release. This receptor can also increase voltage-dependent calcium current in smooth muscles and innervates the blood vessels and the heart in cardiovascular system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced locomotor activity and body temperature, and attenuated behavioral responses to the drugs thioperamide, methamphetamine, and scopolamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730071L15Rik A G 11: 6,200,442 *138W probably null Het
Abcb1a T A 5: 8,737,773 probably null Het
Acp6 T C 3: 97,171,744 probably null Het
Adcyap1 A T 17: 93,204,113 I172L probably benign Het
Adgrf1 A C 17: 43,295,239 I85L probably benign Het
Afdn A T 17: 13,890,966 T1604S probably benign Het
Angpt2 T C 8: 18,692,115 Y475C probably damaging Het
Ank2 A G 3: 126,956,064 S439P probably damaging Het
Ank3 T A 10: 69,976,203 N366K probably damaging Het
Ankrd11 A G 8: 122,900,183 S87P probably benign Het
Ano7 T A 1: 93,395,314 S459T possibly damaging Het
Asxl3 G A 18: 22,523,312 V1460M probably benign Het
Atg16l1 A C 1: 87,767,042 N147T possibly damaging Het
Atp10a T C 7: 58,813,764 V1015A probably damaging Het
Atxn7 T A 14: 14,100,401 S696T probably benign Het
Babam1 C T 8: 71,399,802 T184I probably benign Het
Blk A G 14: 63,381,262 S175P possibly damaging Het
Col5a1 T A 2: 28,024,742 F123L probably damaging Het
Csmd3 T C 15: 48,161,084 Y496C probably damaging Het
Dnah3 A T 7: 120,016,477 Y1676* probably null Het
Fdxacb1 T A 9: 50,771,943 M402K probably benign Het
Frmd5 A G 2: 121,562,924 V141A possibly damaging Het
Gapvd1 G A 2: 34,704,492 R685* probably null Het
Grik2 A G 10: 49,240,730 L645P probably damaging Het
H2afj T A 6: 136,808,683 V115E possibly damaging Het
Kcnc2 A G 10: 112,272,228 T175A probably benign Het
Kcnv2 A G 19: 27,322,932 Y61C probably damaging Het
Kif24 T C 4: 41,394,939 R645G probably damaging Het
Knl1 A G 2: 119,068,957 I380V possibly damaging Het
Lamb2 A G 9: 108,487,501 I1151M possibly damaging Het
Leo1 A G 9: 75,445,877 D234G probably benign Het
Lrp1b T G 2: 41,498,393 N407H probably benign Het
Matn2 T C 15: 34,428,685 S732P probably damaging Het
Mrps30 A T 13: 118,386,895 F114I possibly damaging Het
Olfr1293-ps G A 2: 111,527,448 V45I probably damaging Het
Olfr1487 T C 19: 13,619,702 I180T probably benign Het
Olfr355 T C 2: 36,927,701 N138D probably benign Het
Oxr1 T C 15: 41,813,584 V179A probably benign Het
Plaur A T 7: 24,466,716 S71C possibly damaging Het
Plbd2 T C 5: 120,486,721 N461D possibly damaging Het
Plcb2 T A 2: 118,718,915 Y322F probably damaging Het
Prkab2 T C 3: 97,662,355 V79A probably damaging Het
Ptpn3 A T 4: 57,197,568 C774S probably damaging Het
Ring1 A C 17: 34,023,042 L131R probably benign Het
Rxfp2 G A 5: 150,051,632 probably null Het
Selenbp1 A T 3: 94,937,958 I122F probably benign Het
Sept7 A G 9: 25,306,172 H394R probably benign Het
Slc1a7 G A 4: 108,007,561 V266I probably damaging Het
Slc2a10 A G 2: 165,517,658 T481A probably benign Het
Tapbp A G 17: 33,925,622 M231V probably benign Het
Tbxas1 A T 6: 39,023,047 N256I probably benign Het
Thegl T C 5: 77,037,353 probably null Het
Uimc1 A G 13: 55,093,185 I30T probably damaging Het
Usp48 C A 4: 137,650,358 N231K probably benign Het
Zfhx3 T G 8: 108,947,850 V1844G possibly damaging Het
Znrf3 A T 11: 5,283,422 C212S probably damaging Het
Other mutations in Hrh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01652:Hrh3 APN 2 180101103 missense possibly damaging 0.69
IGL01827:Hrh3 APN 2 180103946 missense possibly damaging 0.95
IGL01912:Hrh3 APN 2 180101376 missense probably damaging 1.00
IGL02992:Hrh3 APN 2 180100815 missense probably benign 0.11
IGL03273:Hrh3 APN 2 180100648 missense possibly damaging 0.85
R1403:Hrh3 UTSW 2 180102754 missense probably damaging 1.00
R1403:Hrh3 UTSW 2 180102754 missense probably damaging 1.00
R1808:Hrh3 UTSW 2 180099784 unclassified probably benign
R2060:Hrh3 UTSW 2 180101250 missense possibly damaging 0.95
R4110:Hrh3 UTSW 2 180102850 missense possibly damaging 0.84
R4111:Hrh3 UTSW 2 180102850 missense possibly damaging 0.84
R4113:Hrh3 UTSW 2 180102850 missense possibly damaging 0.84
R4330:Hrh3 UTSW 2 180099872 unclassified probably benign
R5050:Hrh3 UTSW 2 180100557 missense probably damaging 1.00
R5543:Hrh3 UTSW 2 180103970 missense probably damaging 0.99
R5780:Hrh3 UTSW 2 180100815 missense probably damaging 0.96
R7571:Hrh3 UTSW 2 180101286 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACCCCATACCTGTGCAATG -3'
(R):5'- ATCTGTACAAACCACTGCAGG -3'

Sequencing Primer
(F):5'- CGAGGGTTGGGCATCAG -3'
(R):5'- TGTACAAACCACTGCAGGTCTCC -3'
Posted On2016-04-15