Incidental Mutation 'R4935:Acp6'
ID380285
Institutional Source Beutler Lab
Gene Symbol Acp6
Ensembl Gene ENSMUSG00000028093
Gene Nameacid phosphatase 6, lysophosphatidic
SynonymsACPL1, 5730559A09Rik, mPACPL1
MMRRC Submission 042535-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R4935 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location97158777-97177299 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 97171744 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000088263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090759] [ENSMUST00000090759] [ENSMUST00000090759]
Predicted Effect probably null
Transcript: ENSMUST00000090759
SMART Domains Protein: ENSMUSP00000088263
Gene: ENSMUSG00000028093

DomainStartEndE-ValueType
Pfam:His_Phos_2 42 228 4.6e-20 PFAM
Pfam:His_Phos_2 245 371 8e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000090759
SMART Domains Protein: ENSMUSP00000088263
Gene: ENSMUSG00000028093

DomainStartEndE-ValueType
Pfam:His_Phos_2 42 228 4.6e-20 PFAM
Pfam:His_Phos_2 245 371 8e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000090759
SMART Domains Protein: ENSMUSP00000088263
Gene: ENSMUSG00000028093

DomainStartEndE-ValueType
Pfam:His_Phos_2 42 228 4.6e-20 PFAM
Pfam:His_Phos_2 245 371 8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198329
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 86.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the histidine acid phosphatase protein family. The encoded protein hydrolyzes lysophosphatidic acid, which is involved in G protein-coupled receptor signaling, lipid raft modulation, and in balancing lipid composition within the cell. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2016]
PHENOTYPE: Phenotypic analysis of mice homozygous for a gene trap allele indicates this mutation has no notable phenotype in any parameter tested. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730071L15Rik A G 11: 6,200,442 *138W probably null Het
Abcb1a T A 5: 8,737,773 probably null Het
Adcyap1 A T 17: 93,204,113 I172L probably benign Het
Adgrf1 A C 17: 43,295,239 I85L probably benign Het
Afdn A T 17: 13,890,966 T1604S probably benign Het
Angpt2 T C 8: 18,692,115 Y475C probably damaging Het
Ank2 A G 3: 126,956,064 S439P probably damaging Het
Ank3 T A 10: 69,976,203 N366K probably damaging Het
Ankrd11 A G 8: 122,900,183 S87P probably benign Het
Ano7 T A 1: 93,395,314 S459T possibly damaging Het
Asxl3 G A 18: 22,523,312 V1460M probably benign Het
Atg16l1 A C 1: 87,767,042 N147T possibly damaging Het
Atp10a T C 7: 58,813,764 V1015A probably damaging Het
Atxn7 T A 14: 14,100,401 S696T probably benign Het
Babam1 C T 8: 71,399,802 T184I probably benign Het
Blk A G 14: 63,381,262 S175P possibly damaging Het
Col5a1 T A 2: 28,024,742 F123L probably damaging Het
Csmd3 T C 15: 48,161,084 Y496C probably damaging Het
Dnah3 A T 7: 120,016,477 Y1676* probably null Het
Fdxacb1 T A 9: 50,771,943 M402K probably benign Het
Frmd5 A G 2: 121,562,924 V141A possibly damaging Het
Gapvd1 G A 2: 34,704,492 R685* probably null Het
Grik2 A G 10: 49,240,730 L645P probably damaging Het
H2afj T A 6: 136,808,683 V115E possibly damaging Het
Hrh3 T C 2: 180,101,268 Y189C probably damaging Het
Kcnc2 A G 10: 112,272,228 T175A probably benign Het
Kcnv2 A G 19: 27,322,932 Y61C probably damaging Het
Kif24 T C 4: 41,394,939 R645G probably damaging Het
Knl1 A G 2: 119,068,957 I380V possibly damaging Het
Lamb2 A G 9: 108,487,501 I1151M possibly damaging Het
Leo1 A G 9: 75,445,877 D234G probably benign Het
Lrp1b T G 2: 41,498,393 N407H probably benign Het
Matn2 T C 15: 34,428,685 S732P probably damaging Het
Mrps30 A T 13: 118,386,895 F114I possibly damaging Het
Olfr1293-ps G A 2: 111,527,448 V45I probably damaging Het
Olfr1487 T C 19: 13,619,702 I180T probably benign Het
Olfr355 T C 2: 36,927,701 N138D probably benign Het
Oxr1 T C 15: 41,813,584 V179A probably benign Het
Plaur A T 7: 24,466,716 S71C possibly damaging Het
Plbd2 T C 5: 120,486,721 N461D possibly damaging Het
Plcb2 T A 2: 118,718,915 Y322F probably damaging Het
Prkab2 T C 3: 97,662,355 V79A probably damaging Het
Ptpn3 A T 4: 57,197,568 C774S probably damaging Het
Ring1 A C 17: 34,023,042 L131R probably benign Het
Rxfp2 G A 5: 150,051,632 probably null Het
Selenbp1 A T 3: 94,937,958 I122F probably benign Het
Sept7 A G 9: 25,306,172 H394R probably benign Het
Slc1a7 G A 4: 108,007,561 V266I probably damaging Het
Slc2a10 A G 2: 165,517,658 T481A probably benign Het
Tapbp A G 17: 33,925,622 M231V probably benign Het
Tbxas1 A T 6: 39,023,047 N256I probably benign Het
Thegl T C 5: 77,037,353 probably null Het
Uimc1 A G 13: 55,093,185 I30T probably damaging Het
Usp48 C A 4: 137,650,358 N231K probably benign Het
Zfhx3 T G 8: 108,947,850 V1844G possibly damaging Het
Znrf3 A T 11: 5,283,422 C212S probably damaging Het
Other mutations in Acp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Acp6 APN 3 97176421 missense possibly damaging 0.94
IGL01610:Acp6 APN 3 97175720 missense possibly damaging 0.81
IGL01655:Acp6 APN 3 97165972 critical splice donor site probably null
IGL01788:Acp6 APN 3 97165882 missense probably damaging 1.00
IGL01845:Acp6 APN 3 97173807 missense probably benign 0.00
IGL02978:Acp6 APN 3 97166559 missense probably benign 0.30
IGL03180:Acp6 APN 3 97175635 missense probably benign 0.15
R0144:Acp6 UTSW 3 97165829 splice site probably benign
R0471:Acp6 UTSW 3 97168575 critical splice donor site probably null
R1458:Acp6 UTSW 3 97173788 splice site probably benign
R1889:Acp6 UTSW 3 97165885 missense probably damaging 0.98
R1990:Acp6 UTSW 3 97175738 missense probably damaging 1.00
R2051:Acp6 UTSW 3 97168017 missense probably benign 0.00
R3786:Acp6 UTSW 3 97159289 missense probably damaging 0.98
R3933:Acp6 UTSW 3 97166183 missense probably benign 0.00
R4271:Acp6 UTSW 3 97166618 critical splice donor site probably null
R4604:Acp6 UTSW 3 97175759 missense probably benign 0.23
R4864:Acp6 UTSW 3 97159367 critical splice donor site probably null
R5076:Acp6 UTSW 3 97167989 missense probably benign 0.01
R5255:Acp6 UTSW 3 97167996 missense probably benign 0.11
R5896:Acp6 UTSW 3 97168494 missense probably benign 0.03
R5959:Acp6 UTSW 3 97166572 missense probably damaging 1.00
R6004:Acp6 UTSW 3 97175681 missense probably benign 0.11
R6938:Acp6 UTSW 3 97175633 missense probably benign 0.04
R7593:Acp6 UTSW 3 97165950 missense probably benign 0.30
X0067:Acp6 UTSW 3 97165957 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCGCCCCTATGGTTTAATAG -3'
(R):5'- TGACACTCTGGACTCTGTGTAAC -3'

Sequencing Primer
(F):5'- TAGAAGCTAATTGGCGCCCTTAG -3'
(R):5'- GGACAGAGATACAGGTTCCTACC -3'
Posted On2016-04-15