Incidental Mutation 'R4935:Thegl'
ID380296
Institutional Source Beutler Lab
Gene Symbol Thegl
Ensembl Gene ENSMUSG00000029248
Gene Nametheg spermatid protein like
Synonyms1700023E05Rik
MMRRC Submission 042535-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R4935 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location77016023-77061529 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 77037353 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031161] [ENSMUST00000117880] [ENSMUST00000118941]
Predicted Effect probably benign
Transcript: ENSMUST00000031161
SMART Domains Protein: ENSMUSP00000031161
Gene: ENSMUSG00000029248

DomainStartEndE-ValueType
low complexity region 21 30 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
THEG 172 190 4.56e2 SMART
THEG 212 231 5.84e0 SMART
THEG 258 277 3.1e-1 SMART
THEG 291 310 8.37e2 SMART
THEG 327 346 7.65e1 SMART
THEG 367 386 3.61e1 SMART
THEG 403 422 1.15e1 SMART
THEG 440 459 9.98e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117880
SMART Domains Protein: ENSMUSP00000112814
Gene: ENSMUSG00000029248

DomainStartEndE-ValueType
low complexity region 21 30 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
THEG 172 190 4.56e2 SMART
THEG 212 231 5.84e0 SMART
THEG 258 277 3.1e-1 SMART
THEG 291 310 8.37e2 SMART
THEG 327 346 7.65e1 SMART
THEG 367 386 3.61e1 SMART
THEG 403 422 1.15e1 SMART
THEG 440 459 9.98e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118941
SMART Domains Protein: ENSMUSP00000112660
Gene: ENSMUSG00000029248

DomainStartEndE-ValueType
Pfam:THEG 25 57 1.6e-4 PFAM
Pfam:THEG 60 124 1.5e-14 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 86.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730071L15Rik A G 11: 6,200,442 *138W probably null Het
Abcb1a T A 5: 8,737,773 probably null Het
Acp6 T C 3: 97,171,744 probably null Het
Adcyap1 A T 17: 93,204,113 I172L probably benign Het
Adgrf1 A C 17: 43,295,239 I85L probably benign Het
Afdn A T 17: 13,890,966 T1604S probably benign Het
Angpt2 T C 8: 18,692,115 Y475C probably damaging Het
Ank2 A G 3: 126,956,064 S439P probably damaging Het
Ank3 T A 10: 69,976,203 N366K probably damaging Het
Ankrd11 A G 8: 122,900,183 S87P probably benign Het
Ano7 T A 1: 93,395,314 S459T possibly damaging Het
Asxl3 G A 18: 22,523,312 V1460M probably benign Het
Atg16l1 A C 1: 87,767,042 N147T possibly damaging Het
Atp10a T C 7: 58,813,764 V1015A probably damaging Het
Atxn7 T A 14: 14,100,401 S696T probably benign Het
Babam1 C T 8: 71,399,802 T184I probably benign Het
Blk A G 14: 63,381,262 S175P possibly damaging Het
Col5a1 T A 2: 28,024,742 F123L probably damaging Het
Csmd3 T C 15: 48,161,084 Y496C probably damaging Het
Dnah3 A T 7: 120,016,477 Y1676* probably null Het
Fdxacb1 T A 9: 50,771,943 M402K probably benign Het
Frmd5 A G 2: 121,562,924 V141A possibly damaging Het
Gapvd1 G A 2: 34,704,492 R685* probably null Het
Grik2 A G 10: 49,240,730 L645P probably damaging Het
H2afj T A 6: 136,808,683 V115E possibly damaging Het
Hrh3 T C 2: 180,101,268 Y189C probably damaging Het
Kcnc2 A G 10: 112,272,228 T175A probably benign Het
Kcnv2 A G 19: 27,322,932 Y61C probably damaging Het
Kif24 T C 4: 41,394,939 R645G probably damaging Het
Knl1 A G 2: 119,068,957 I380V possibly damaging Het
Lamb2 A G 9: 108,487,501 I1151M possibly damaging Het
Leo1 A G 9: 75,445,877 D234G probably benign Het
Lrp1b T G 2: 41,498,393 N407H probably benign Het
Matn2 T C 15: 34,428,685 S732P probably damaging Het
Mrps30 A T 13: 118,386,895 F114I possibly damaging Het
Olfr1293-ps G A 2: 111,527,448 V45I probably damaging Het
Olfr1487 T C 19: 13,619,702 I180T probably benign Het
Olfr355 T C 2: 36,927,701 N138D probably benign Het
Oxr1 T C 15: 41,813,584 V179A probably benign Het
Plaur A T 7: 24,466,716 S71C possibly damaging Het
Plbd2 T C 5: 120,486,721 N461D possibly damaging Het
Plcb2 T A 2: 118,718,915 Y322F probably damaging Het
Prkab2 T C 3: 97,662,355 V79A probably damaging Het
Ptpn3 A T 4: 57,197,568 C774S probably damaging Het
Ring1 A C 17: 34,023,042 L131R probably benign Het
Rxfp2 G A 5: 150,051,632 probably null Het
Selenbp1 A T 3: 94,937,958 I122F probably benign Het
Sept7 A G 9: 25,306,172 H394R probably benign Het
Slc1a7 G A 4: 108,007,561 V266I probably damaging Het
Slc2a10 A G 2: 165,517,658 T481A probably benign Het
Tapbp A G 17: 33,925,622 M231V probably benign Het
Tbxas1 A T 6: 39,023,047 N256I probably benign Het
Uimc1 A G 13: 55,093,185 I30T probably damaging Het
Usp48 C A 4: 137,650,358 N231K probably benign Het
Zfhx3 T G 8: 108,947,850 V1844G possibly damaging Het
Znrf3 A T 11: 5,283,422 C212S probably damaging Het
Other mutations in Thegl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Thegl APN 5 77060831 missense probably damaging 1.00
IGL02008:Thegl APN 5 77060758 missense probably benign 0.01
IGL02014:Thegl APN 5 77047155 missense probably damaging 0.99
IGL02525:Thegl APN 5 77016553 missense probably benign 0.08
IGL03036:Thegl APN 5 77016350 missense possibly damaging 0.86
IGL03200:Thegl APN 5 77060864 missense possibly damaging 0.66
IGL03302:Thegl APN 5 77054576 missense probably benign 0.09
R0242:Thegl UTSW 5 77016305 nonsense probably null
R0242:Thegl UTSW 5 77016305 nonsense probably null
R0483:Thegl UTSW 5 77037357 splice site probably benign
R1875:Thegl UTSW 5 77054584 missense probably benign 0.29
R2121:Thegl UTSW 5 77060758 missense probably benign 0.01
R2232:Thegl UTSW 5 77059405 missense possibly damaging 0.84
R2280:Thegl UTSW 5 77059367 missense probably damaging 1.00
R2281:Thegl UTSW 5 77059367 missense probably damaging 1.00
R4422:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4423:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4424:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R5041:Thegl UTSW 5 77056081 missense probably benign 0.05
R5175:Thegl UTSW 5 77016470 missense probably benign 0.00
R5560:Thegl UTSW 5 77016486 missense possibly damaging 0.61
R6086:Thegl UTSW 5 77061305 missense probably benign 0.11
R6193:Thegl UTSW 5 77016336 missense possibly damaging 0.85
R7070:Thegl UTSW 5 77047277 critical splice donor site probably null
R7453:Thegl UTSW 5 77060786 missense probably damaging 1.00
R7703:Thegl UTSW 5 77016597 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TCAACAGTGCCAGCCTTCTC -3'
(R):5'- GACTTTTGGAGGGCTTCAAGAG -3'

Sequencing Primer
(F):5'- GTGCCAGCCTTCTCCATAAGAG -3'
(R):5'- AGAGCCTCACCAGCTTTATC -3'
Posted On2016-04-15