Mutagenetix > Incidental Mutations

Incidental Mutation 'R4935:Rxfp2'

380298

Institutional Source

Beutler Lab

Gene Symbol

Rxfp2

Ensembl Gene

ENSMUSG00000053368

Gene Name

relaxin/insulin-like family peptide receptor 2

Synonyms

Gpr106, Great, LGR8

MMRRC Submission

042535-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4935 (G1)

Quality Score

104

Status

Not validated

Chromosome

Chromosomal Location

150018675-150082184 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 150051632 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000144536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065745] [ENSMUST00000110496] [ENSMUST00000201612]

Predicted Effect

probably null
Transcript: ENSMUST00000065745

SMART Domains

Protein: ENSMUSP00000067897
Gene: ENSMUSG00000053368

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LDLa	27	65	2.55e-11	SMART
LRRNT	93	124	3.83e0	SMART
LRR	120	142	1.71e2	SMART
LRR	143	166	6.77e0	SMART
LRR_TYP	167	190	2.84e-5	SMART
LRR	191	214	7.36e0	SMART
LRR	215	238	1.26e1	SMART
LRR	239	262	2.61e1	SMART
LRR	263	286	8.98e1	SMART
LRR_TYP	287	310	2.24e-3	SMART
LRR	311	334	1.15e1	SMART
LRR	335	358	2.14e1	SMART
Pfam:7tm_1	415	674	1.4e-26	PFAM
low complexity region	682	695	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000110496

SMART Domains

Protein: ENSMUSP00000106122
Gene: ENSMUSG00000053368

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LDLa	27	65	2.55e-11	SMART
LRRNT	93	124	3.83e0	SMART
LRR	120	142	1.71e2	SMART
LRR	143	166	6.77e0	SMART
LRR_TYP	167	190	2.84e-5	SMART
LRR	191	214	7.36e0	SMART
LRR	215	238	1.26e1	SMART
LRR	239	262	2.61e1	SMART
LRR	263	286	2.82e0	SMART
LRR	287	310	1.15e1	SMART
LRR	311	334	2.14e1	SMART
Pfam:7tm_1	391	650	1.5e-27	PFAM
low complexity region	658	671	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143989

Predicted Effect

probably null
Transcript: ENSMUST00000201612

SMART Domains

Protein: ENSMUSP00000144536
Gene: ENSMUSG00000053368

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LDLa	27	65	1.3e-13	SMART
LRRNT	93	124	1.9e-2	SMART
LRR	120	142	7.4e-1	SMART
LRR	143	166	2.9e-2	SMART
LRR_TYP	167	190	1.2e-7	SMART
LRR	229	252	5.4e-2	SMART
LRR	253	276	1.1e-1	SMART
LRR	277	300	1.2e-2	SMART
LRR	301	324	5e-2	SMART
LRR	325	348	9.3e-2	SMART
Pfam:7tm_1	405	664	1.5e-24	PFAM
low complexity region	672	685	N/A	INTRINSIC

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 94.8%
20x: 86.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GPCR (G protein-coupled, 7-transmembrane receptor) family. Mutations in this gene are associated with cryptorchidism. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Male homozygotes for a targeted null mutation exhibit bilateral intraabdominal cryptorchidism and sterility associated with a failure in the differentiation of the gubernaculae, ligaments that control testicular movement during development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730071L15Rik	A	G	11: 6,200,442	*138W	probably null	Het
Abcb1a	T	A	5: 8,737,773		probably null	Het
Acp6	T	C	3: 97,171,744		probably null	Het
Adcyap1	A	T	17: 93,204,113	I172L	probably benign	Het
Adgrf1	A	C	17: 43,295,239	I85L	probably benign	Het
Afdn	A	T	17: 13,890,966	T1604S	probably benign	Het
Angpt2	T	C	8: 18,692,115	Y475C	probably damaging	Het
Ank2	A	G	3: 126,956,064	S439P	probably damaging	Het
Ank3	T	A	10: 69,976,203	N366K	probably damaging	Het
Ankrd11	A	G	8: 122,900,183	S87P	probably benign	Het
Ano7	T	A	1: 93,395,314	S459T	possibly damaging	Het
Asxl3	G	A	18: 22,523,312	V1460M	probably benign	Het
Atg16l1	A	C	1: 87,767,042	N147T	possibly damaging	Het
Atp10a	T	C	7: 58,813,764	V1015A	probably damaging	Het
Atxn7	T	A	14: 14,100,401	S696T	probably benign	Het
Babam1	C	T	8: 71,399,802	T184I	probably benign	Het
Blk	A	G	14: 63,381,262	S175P	possibly damaging	Het
Col5a1	T	A	2: 28,024,742	F123L	probably damaging	Het
Csmd3	T	C	15: 48,161,084	Y496C	probably damaging	Het
Dnah3	A	T	7: 120,016,477	Y1676*	probably null	Het
Fdxacb1	T	A	9: 50,771,943	M402K	probably benign	Het
Frmd5	A	G	2: 121,562,924	V141A	possibly damaging	Het
Gapvd1	G	A	2: 34,704,492	R685*	probably null	Het
Grik2	A	G	10: 49,240,730	L645P	probably damaging	Het
H2afj	T	A	6: 136,808,683	V115E	possibly damaging	Het
Hrh3	T	C	2: 180,101,268	Y189C	probably damaging	Het
Kcnc2	A	G	10: 112,272,228	T175A	probably benign	Het
Kcnv2	A	G	19: 27,322,932	Y61C	probably damaging	Het
Kif24	T	C	4: 41,394,939	R645G	probably damaging	Het
Knl1	A	G	2: 119,068,957	I380V	possibly damaging	Het
Lamb2	A	G	9: 108,487,501	I1151M	possibly damaging	Het
Leo1	A	G	9: 75,445,877	D234G	probably benign	Het
Lrp1b	T	G	2: 41,498,393	N407H	probably benign	Het
Matn2	T	C	15: 34,428,685	S732P	probably damaging	Het
Mrps30	A	T	13: 118,386,895	F114I	possibly damaging	Het
Olfr1293-ps	G	A	2: 111,527,448	V45I	probably damaging	Het
Olfr1487	T	C	19: 13,619,702	I180T	probably benign	Het
Olfr355	T	C	2: 36,927,701	N138D	probably benign	Het
Oxr1	T	C	15: 41,813,584	V179A	probably benign	Het
Plaur	A	T	7: 24,466,716	S71C	possibly damaging	Het
Plbd2	T	C	5: 120,486,721	N461D	possibly damaging	Het
Plcb2	T	A	2: 118,718,915	Y322F	probably damaging	Het
Prkab2	T	C	3: 97,662,355	V79A	probably damaging	Het
Ptpn3	A	T	4: 57,197,568	C774S	probably damaging	Het
Ring1	A	C	17: 34,023,042	L131R	probably benign	Het
Selenbp1	A	T	3: 94,937,958	I122F	probably benign	Het
Sept7	A	G	9: 25,306,172	H394R	probably benign	Het
Slc1a7	G	A	4: 108,007,561	V266I	probably damaging	Het
Slc2a10	A	G	2: 165,517,658	T481A	probably benign	Het
Tapbp	A	G	17: 33,925,622	M231V	probably benign	Het
Tbxas1	A	T	6: 39,023,047	N256I	probably benign	Het
Thegl	T	C	5: 77,037,353		probably null	Het
Uimc1	A	G	13: 55,093,185	I30T	probably damaging	Het
Usp48	C	A	4: 137,650,358	N231K	probably benign	Het
Zfhx3	T	G	8: 108,947,850	V1844G	possibly damaging	Het
Znrf3	A	T	11: 5,283,422	C212S	probably damaging	Het

Other mutations in Rxfp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00832:Rxfp2	APN	5	150066428	missense	probably benign
IGL00984:Rxfp2	APN	5	150067132	missense	probably benign	0.24
IGL02475:Rxfp2	APN	5	150063686	missense	probably benign	0.07
IGL02637:Rxfp2	APN	5	150055913	missense	probably damaging	0.99
IGL02992:Rxfp2	APN	5	150051556	missense	probably benign	0.01
IGL03052:Rxfp2	APN	5	150043180	splice site	probably benign
IGL03203:Rxfp2	APN	5	150063680	missense	probably benign	0.08
R0158:Rxfp2	UTSW	5	150051628	missense	probably benign	0.14
R0394:Rxfp2	UTSW	5	150067388	missense	probably benign	0.03
R0499:Rxfp2	UTSW	5	150066415	missense	probably damaging	1.00
R0576:Rxfp2	UTSW	5	150038247	missense	probably benign	0.01
R0720:Rxfp2	UTSW	5	150044119	missense	probably benign	0.04
R1172:Rxfp2	UTSW	5	150051556	missense	probably benign	0.01
R1173:Rxfp2	UTSW	5	150051556	missense	probably benign	0.01
R1174:Rxfp2	UTSW	5	150051556	missense	probably benign	0.01
R1175:Rxfp2	UTSW	5	150051556	missense	probably benign	0.01
R1606:Rxfp2	UTSW	5	150059897	missense	probably benign
R1720:Rxfp2	UTSW	5	150043099	nonsense	probably null
R2040:Rxfp2	UTSW	5	150070212	missense	probably benign
R3029:Rxfp2	UTSW	5	150043130	missense	probably benign	0.05
R3905:Rxfp2	UTSW	5	150055985	splice site	probably null
R4056:Rxfp2	UTSW	5	150051633	critical splice donor site	probably null
R4156:Rxfp2	UTSW	5	150051555	missense	probably benign	0.01
R4282:Rxfp2	UTSW	5	150070270	missense	possibly damaging	0.94
R4418:Rxfp2	UTSW	5	150048800	missense	probably benign
R5010:Rxfp2	UTSW	5	150067360	missense	probably damaging	1.00
R5286:Rxfp2	UTSW	5	150035444	missense	probably damaging	1.00
R5373:Rxfp2	UTSW	5	150070260	missense	probably benign	0.21
R5374:Rxfp2	UTSW	5	150070260	missense	probably benign	0.21
R5530:Rxfp2	UTSW	5	150056810	missense	probably damaging	1.00
R5844:Rxfp2	UTSW	5	150043124	missense	probably benign	0.00
R6021:Rxfp2	UTSW	5	150063737	missense	possibly damaging	0.46
R6211:Rxfp2	UTSW	5	150044126	splice site	probably null
R6401:Rxfp2	UTSW	5	150043130	missense	probably benign
R6841:Rxfp2	UTSW	5	150018745	start gained	probably benign
R6981:Rxfp2	UTSW	5	150048848	splice site	probably null
R7012:Rxfp2	UTSW	5	150081194	missense	probably benign	0.00
R7032:Rxfp2	UTSW	5	150070348	missense	probably damaging	1.00
R7151:Rxfp2	UTSW	5	150043107	missense	probably benign	0.01
R7205:Rxfp2	UTSW	5	150059899	missense	probably benign	0.05
R7205:Rxfp2	UTSW	5	150059903	missense	probably benign	0.00
R7209:Rxfp2	UTSW	5	150053098	intron	probably null
R7468:Rxfp2	UTSW	5	150067336	missense	possibly damaging	0.70
R7475:Rxfp2	UTSW	5	150049581	missense	possibly damaging	0.94
X0067:Rxfp2	UTSW	5	150051618	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAATTGTGTCCCATGGGG -3'
(R):5'- AACTTTTGTTCAACCGCTGCAG -3'

Sequencing Primer
(F):5'- AACACCTGTGTCCCATGGG -3'
(R):5'- CTGCAGATGAAAACATGGCTTATTCC -3'

Posted On

2016-04-15