Incidental Mutation 'R4935:Plaur'
ID380301
Institutional Source Beutler Lab
Gene Symbol Plaur
Ensembl Gene ENSMUSG00000046223
Gene Nameplasminogen activator, urokinase receptor
SynonymsuPAR, Cd87, urokinase-type plasminogen activator receptor, u-PAR
MMRRC Submission 042535-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R4935 (G1)
Quality Score219
Status Not validated
Chromosome7
Chromosomal Location24462484-24475968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24466716 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 71 (S71C)
Ref Sequence ENSEMBL: ENSMUSP00000145632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002284] [ENSMUST00000206514] [ENSMUST00000206935]
Predicted Effect probably benign
Transcript: ENSMUST00000002284
AA Change: S71C

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000002284
Gene: ENSMUSG00000046223
AA Change: S71C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LU 24 114 1.9e-29 SMART
LU 117 206 2.36e-25 SMART
LU 213 308 1.17e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205877
Predicted Effect possibly damaging
Transcript: ENSMUST00000206514
AA Change: S71C

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206636
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206693
Predicted Effect probably benign
Transcript: ENSMUST00000206935
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 86.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the receptor for urokinase plasminogen activator and, given its role in localizing and promoting plasmin formation, likely influences many normal and pathological processes related to cell-surface plasminogen activation and localized degradation of the extracellular matrix. It binds both the proprotein and mature forms of urokinase plasminogen activator and permits the activation of the receptor-bound pro-enzyme by plasmin. The protein lacks transmembrane or cytoplasmic domains and may be anchored to the plasma membrane by a glycosyl-phosphatidylinositol (GPI) moiety following cleavage of the nascent polypeptide near its carboxy-terminus. However, a soluble protein is also produced in some cell types. Alternative splicing results in multiple transcript variants encoding different isoforms. The proprotein experiences several post-translational cleavage reactions that have not yet been fully defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele exhibit chronic inflammation, macrophage dysfunction, and reduced angiogenesis. Homozygotes for another null allele show neutrophil dysfunction, increased anxiety, loss of GABAergic neurons, myoclonus, and susceptibility to bacterial infection and PTZ -induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730071L15Rik A G 11: 6,200,442 *138W probably null Het
Abcb1a T A 5: 8,737,773 probably null Het
Acp6 T C 3: 97,171,744 probably null Het
Adcyap1 A T 17: 93,204,113 I172L probably benign Het
Adgrf1 A C 17: 43,295,239 I85L probably benign Het
Afdn A T 17: 13,890,966 T1604S probably benign Het
Angpt2 T C 8: 18,692,115 Y475C probably damaging Het
Ank2 A G 3: 126,956,064 S439P probably damaging Het
Ank3 T A 10: 69,976,203 N366K probably damaging Het
Ankrd11 A G 8: 122,900,183 S87P probably benign Het
Ano7 T A 1: 93,395,314 S459T possibly damaging Het
Asxl3 G A 18: 22,523,312 V1460M probably benign Het
Atg16l1 A C 1: 87,767,042 N147T possibly damaging Het
Atp10a T C 7: 58,813,764 V1015A probably damaging Het
Atxn7 T A 14: 14,100,401 S696T probably benign Het
Babam1 C T 8: 71,399,802 T184I probably benign Het
Blk A G 14: 63,381,262 S175P possibly damaging Het
Col5a1 T A 2: 28,024,742 F123L probably damaging Het
Csmd3 T C 15: 48,161,084 Y496C probably damaging Het
Dnah3 A T 7: 120,016,477 Y1676* probably null Het
Fdxacb1 T A 9: 50,771,943 M402K probably benign Het
Frmd5 A G 2: 121,562,924 V141A possibly damaging Het
Gapvd1 G A 2: 34,704,492 R685* probably null Het
Grik2 A G 10: 49,240,730 L645P probably damaging Het
H2afj T A 6: 136,808,683 V115E possibly damaging Het
Hrh3 T C 2: 180,101,268 Y189C probably damaging Het
Kcnc2 A G 10: 112,272,228 T175A probably benign Het
Kcnv2 A G 19: 27,322,932 Y61C probably damaging Het
Kif24 T C 4: 41,394,939 R645G probably damaging Het
Knl1 A G 2: 119,068,957 I380V possibly damaging Het
Lamb2 A G 9: 108,487,501 I1151M possibly damaging Het
Leo1 A G 9: 75,445,877 D234G probably benign Het
Lrp1b T G 2: 41,498,393 N407H probably benign Het
Matn2 T C 15: 34,428,685 S732P probably damaging Het
Mrps30 A T 13: 118,386,895 F114I possibly damaging Het
Olfr1293-ps G A 2: 111,527,448 V45I probably damaging Het
Olfr1487 T C 19: 13,619,702 I180T probably benign Het
Olfr355 T C 2: 36,927,701 N138D probably benign Het
Oxr1 T C 15: 41,813,584 V179A probably benign Het
Plbd2 T C 5: 120,486,721 N461D possibly damaging Het
Plcb2 T A 2: 118,718,915 Y322F probably damaging Het
Prkab2 T C 3: 97,662,355 V79A probably damaging Het
Ptpn3 A T 4: 57,197,568 C774S probably damaging Het
Ring1 A C 17: 34,023,042 L131R probably benign Het
Rxfp2 G A 5: 150,051,632 probably null Het
Selenbp1 A T 3: 94,937,958 I122F probably benign Het
Sept7 A G 9: 25,306,172 H394R probably benign Het
Slc1a7 G A 4: 108,007,561 V266I probably damaging Het
Slc2a10 A G 2: 165,517,658 T481A probably benign Het
Tapbp A G 17: 33,925,622 M231V probably benign Het
Tbxas1 A T 6: 39,023,047 N256I probably benign Het
Thegl T C 5: 77,037,353 probably null Het
Uimc1 A G 13: 55,093,185 I30T probably damaging Het
Usp48 C A 4: 137,650,358 N231K probably benign Het
Zfhx3 T G 8: 108,947,850 V1844G possibly damaging Het
Znrf3 A T 11: 5,283,422 C212S probably damaging Het
Other mutations in Plaur
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1513:Plaur UTSW 7 24472591 missense probably benign 0.00
R4229:Plaur UTSW 7 24466783 missense probably damaging 0.99
R6199:Plaur UTSW 7 24465203 missense possibly damaging 0.91
R6254:Plaur UTSW 7 24466800 missense possibly damaging 0.95
X0020:Plaur UTSW 7 24472709 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCTGAAAATCCACGTGACG -3'
(R):5'- ACTGGGGTAATGCAGGTCTG -3'

Sequencing Primer
(F):5'- TTCTAGAAGATAACAGAGTGGGCTC -3'
(R):5'- TAATGCAGGTCTGGGGATAGAATTG -3'
Posted On2016-04-15