Incidental Mutation 'R4935:Sept7'
ID380308
Institutional Source Beutler Lab
Gene Symbol Sept7
Ensembl Gene ENSMUSG00000001833
Gene Nameseptin 7
SynonymsCdc10
MMRRC Submission 042535-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4935 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location25252439-25308571 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25306172 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 394 (H394R)
Ref Sequence ENSEMBL: ENSMUSP00000127641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115272] [ENSMUST00000165594]
Predicted Effect probably benign
Transcript: ENSMUST00000115272
AA Change: H394R

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000110927
Gene: ENSMUSG00000001833
AA Change: H394R

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Septin 47 323 1.7e-126 PFAM
Pfam:MMR_HSR1 52 252 2.5e-8 PFAM
low complexity region 349 371 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165594
AA Change: H394R

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000127641
Gene: ENSMUSG00000001833
AA Change: H394R

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Septin 47 323 1.6e-126 PFAM
Pfam:MMR_HSR1 52 197 4.9e-8 PFAM
low complexity region 349 371 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217598
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 86.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a conditional allele activated in neurons exhibit reduced axon and dendrite length and complexity. Mice homozygous for a knock-out allele die prior to E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730071L15Rik A G 11: 6,200,442 *138W probably null Het
Abcb1a T A 5: 8,737,773 probably null Het
Acp6 T C 3: 97,171,744 probably null Het
Adcyap1 A T 17: 93,204,113 I172L probably benign Het
Adgrf1 A C 17: 43,295,239 I85L probably benign Het
Afdn A T 17: 13,890,966 T1604S probably benign Het
Angpt2 T C 8: 18,692,115 Y475C probably damaging Het
Ank2 A G 3: 126,956,064 S439P probably damaging Het
Ank3 T A 10: 69,976,203 N366K probably damaging Het
Ankrd11 A G 8: 122,900,183 S87P probably benign Het
Ano7 T A 1: 93,395,314 S459T possibly damaging Het
Asxl3 G A 18: 22,523,312 V1460M probably benign Het
Atg16l1 A C 1: 87,767,042 N147T possibly damaging Het
Atp10a T C 7: 58,813,764 V1015A probably damaging Het
Atxn7 T A 14: 14,100,401 S696T probably benign Het
Babam1 C T 8: 71,399,802 T184I probably benign Het
Blk A G 14: 63,381,262 S175P possibly damaging Het
Col5a1 T A 2: 28,024,742 F123L probably damaging Het
Csmd3 T C 15: 48,161,084 Y496C probably damaging Het
Dnah3 A T 7: 120,016,477 Y1676* probably null Het
Fdxacb1 T A 9: 50,771,943 M402K probably benign Het
Frmd5 A G 2: 121,562,924 V141A possibly damaging Het
Gapvd1 G A 2: 34,704,492 R685* probably null Het
Grik2 A G 10: 49,240,730 L645P probably damaging Het
H2afj T A 6: 136,808,683 V115E possibly damaging Het
Hrh3 T C 2: 180,101,268 Y189C probably damaging Het
Kcnc2 A G 10: 112,272,228 T175A probably benign Het
Kcnv2 A G 19: 27,322,932 Y61C probably damaging Het
Kif24 T C 4: 41,394,939 R645G probably damaging Het
Knl1 A G 2: 119,068,957 I380V possibly damaging Het
Lamb2 A G 9: 108,487,501 I1151M possibly damaging Het
Leo1 A G 9: 75,445,877 D234G probably benign Het
Lrp1b T G 2: 41,498,393 N407H probably benign Het
Matn2 T C 15: 34,428,685 S732P probably damaging Het
Mrps30 A T 13: 118,386,895 F114I possibly damaging Het
Olfr1293-ps G A 2: 111,527,448 V45I probably damaging Het
Olfr1487 T C 19: 13,619,702 I180T probably benign Het
Olfr355 T C 2: 36,927,701 N138D probably benign Het
Oxr1 T C 15: 41,813,584 V179A probably benign Het
Plaur A T 7: 24,466,716 S71C possibly damaging Het
Plbd2 T C 5: 120,486,721 N461D possibly damaging Het
Plcb2 T A 2: 118,718,915 Y322F probably damaging Het
Prkab2 T C 3: 97,662,355 V79A probably damaging Het
Ptpn3 A T 4: 57,197,568 C774S probably damaging Het
Ring1 A C 17: 34,023,042 L131R probably benign Het
Rxfp2 G A 5: 150,051,632 probably null Het
Selenbp1 A T 3: 94,937,958 I122F probably benign Het
Slc1a7 G A 4: 108,007,561 V266I probably damaging Het
Slc2a10 A G 2: 165,517,658 T481A probably benign Het
Tapbp A G 17: 33,925,622 M231V probably benign Het
Tbxas1 A T 6: 39,023,047 N256I probably benign Het
Thegl T C 5: 77,037,353 probably null Het
Uimc1 A G 13: 55,093,185 I30T probably damaging Het
Usp48 C A 4: 137,650,358 N231K probably benign Het
Zfhx3 T G 8: 108,947,850 V1844G possibly damaging Het
Znrf3 A T 11: 5,283,422 C212S probably damaging Het
Other mutations in Sept7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02692:Sept7 APN 9 25296490 splice site probably benign
R0331:Sept7 UTSW 9 25306256 missense probably benign 0.00
R1590:Sept7 UTSW 9 25277604 missense probably damaging 0.99
R2040:Sept7 UTSW 9 25288236 missense possibly damaging 0.79
R5246:Sept7 UTSW 9 25299536 missense probably damaging 1.00
R5426:Sept7 UTSW 9 25286690 missense possibly damaging 0.92
R5629:Sept7 UTSW 9 25288293 missense probably damaging 1.00
R5994:Sept7 UTSW 9 25288198 missense possibly damaging 0.52
R6177:Sept7 UTSW 9 25293804 critical splice donor site probably null
R6246:Sept7 UTSW 9 25307521 missense probably benign 0.00
R6735:Sept7 UTSW 9 25303752 missense possibly damaging 0.94
R7561:Sept7 UTSW 9 25297855 missense possibly damaging 0.77
X0066:Sept7 UTSW 9 25306140 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ATCCACTTGTGAACCTAAAACAGTG -3'
(R):5'- ATGAGATGTATGATGCAATATGGTG -3'

Sequencing Primer
(F):5'- CCTAAAACAGTGAAATAACAGTTGTC -3'
(R):5'- TGTATGATGCAATATGGTGTTTTAGG -3'
Posted On2016-04-15