Incidental Mutation 'R4935:Leo1'
ID380310
Institutional Source Beutler Lab
Gene Symbol Leo1
Ensembl Gene ENSMUSG00000042487
Gene NameLeo1, Paf1/RNA polymerase II complex component
SynonymsLOC235497
MMRRC Submission 042535-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4935 (G1)
Quality Score203
Status Not validated
Chromosome9
Chromosomal Location75441524-75466432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75445877 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 234 (D234G)
Ref Sequence ENSEMBL: ENSMUSP00000046905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048937]
Predicted Effect probably benign
Transcript: ENSMUST00000048937
AA Change: D234G

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000046905
Gene: ENSMUSG00000042487
AA Change: D234G

DomainStartEndE-ValueType
low complexity region 10 30 N/A INTRINSIC
low complexity region 33 43 N/A INTRINSIC
low complexity region 64 78 N/A INTRINSIC
internal_repeat_1 82 160 7.97e-7 PROSPERO
internal_repeat_1 177 253 7.97e-7 PROSPERO
low complexity region 255 269 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
low complexity region 345 356 N/A INTRINSIC
Pfam:Leo1 375 537 5.8e-58 PFAM
low complexity region 578 584 N/A INTRINSIC
low complexity region 608 618 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213767
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 86.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LEO1, parafibromin (CDC73; MIM 607393), CTR9 (MIM 609366), and PAF1 (MIM 610506) form the PAF protein complex that associates with the RNA polymerase II subunit POLR2A (MIM 180660) and with a histone methyltransferase complex (Rozenblatt-Rosen et al., 2005 [PubMed 15632063]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730071L15Rik A G 11: 6,200,442 *138W probably null Het
Abcb1a T A 5: 8,737,773 probably null Het
Acp6 T C 3: 97,171,744 probably null Het
Adcyap1 A T 17: 93,204,113 I172L probably benign Het
Adgrf1 A C 17: 43,295,239 I85L probably benign Het
Afdn A T 17: 13,890,966 T1604S probably benign Het
Angpt2 T C 8: 18,692,115 Y475C probably damaging Het
Ank2 A G 3: 126,956,064 S439P probably damaging Het
Ank3 T A 10: 69,976,203 N366K probably damaging Het
Ankrd11 A G 8: 122,900,183 S87P probably benign Het
Ano7 T A 1: 93,395,314 S459T possibly damaging Het
Asxl3 G A 18: 22,523,312 V1460M probably benign Het
Atg16l1 A C 1: 87,767,042 N147T possibly damaging Het
Atp10a T C 7: 58,813,764 V1015A probably damaging Het
Atxn7 T A 14: 14,100,401 S696T probably benign Het
Babam1 C T 8: 71,399,802 T184I probably benign Het
Blk A G 14: 63,381,262 S175P possibly damaging Het
Col5a1 T A 2: 28,024,742 F123L probably damaging Het
Csmd3 T C 15: 48,161,084 Y496C probably damaging Het
Dnah3 A T 7: 120,016,477 Y1676* probably null Het
Fdxacb1 T A 9: 50,771,943 M402K probably benign Het
Frmd5 A G 2: 121,562,924 V141A possibly damaging Het
Gapvd1 G A 2: 34,704,492 R685* probably null Het
Grik2 A G 10: 49,240,730 L645P probably damaging Het
H2afj T A 6: 136,808,683 V115E possibly damaging Het
Hrh3 T C 2: 180,101,268 Y189C probably damaging Het
Kcnc2 A G 10: 112,272,228 T175A probably benign Het
Kcnv2 A G 19: 27,322,932 Y61C probably damaging Het
Kif24 T C 4: 41,394,939 R645G probably damaging Het
Knl1 A G 2: 119,068,957 I380V possibly damaging Het
Lamb2 A G 9: 108,487,501 I1151M possibly damaging Het
Lrp1b T G 2: 41,498,393 N407H probably benign Het
Matn2 T C 15: 34,428,685 S732P probably damaging Het
Mrps30 A T 13: 118,386,895 F114I possibly damaging Het
Olfr1293-ps G A 2: 111,527,448 V45I probably damaging Het
Olfr1487 T C 19: 13,619,702 I180T probably benign Het
Olfr355 T C 2: 36,927,701 N138D probably benign Het
Oxr1 T C 15: 41,813,584 V179A probably benign Het
Plaur A T 7: 24,466,716 S71C possibly damaging Het
Plbd2 T C 5: 120,486,721 N461D possibly damaging Het
Plcb2 T A 2: 118,718,915 Y322F probably damaging Het
Prkab2 T C 3: 97,662,355 V79A probably damaging Het
Ptpn3 A T 4: 57,197,568 C774S probably damaging Het
Ring1 A C 17: 34,023,042 L131R probably benign Het
Rxfp2 G A 5: 150,051,632 probably null Het
Selenbp1 A T 3: 94,937,958 I122F probably benign Het
Sept7 A G 9: 25,306,172 H394R probably benign Het
Slc1a7 G A 4: 108,007,561 V266I probably damaging Het
Slc2a10 A G 2: 165,517,658 T481A probably benign Het
Tapbp A G 17: 33,925,622 M231V probably benign Het
Tbxas1 A T 6: 39,023,047 N256I probably benign Het
Thegl T C 5: 77,037,353 probably null Het
Uimc1 A G 13: 55,093,185 I30T probably damaging Het
Usp48 C A 4: 137,650,358 N231K probably benign Het
Zfhx3 T G 8: 108,947,850 V1844G possibly damaging Het
Znrf3 A T 11: 5,283,422 C212S probably damaging Het
Other mutations in Leo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Leo1 APN 9 75450480 splice site probably benign
IGL01412:Leo1 APN 9 75466242 missense probably benign 0.08
IGL01789:Leo1 APN 9 75454614 splice site probably benign
IGL02116:Leo1 APN 9 75449415 missense probably damaging 1.00
IGL02303:Leo1 APN 9 75445999 splice site probably benign
FR4449:Leo1 UTSW 9 75450573 critical splice donor site probably benign
FR4976:Leo1 UTSW 9 75450572 critical splice donor site probably benign
R0729:Leo1 UTSW 9 75457138 missense possibly damaging 0.78
R0811:Leo1 UTSW 9 75445549 missense probably benign 0.02
R0812:Leo1 UTSW 9 75445549 missense probably benign 0.02
R0960:Leo1 UTSW 9 75445240 missense probably benign 0.01
R1272:Leo1 UTSW 9 75450513 missense possibly damaging 0.95
R1349:Leo1 UTSW 9 75449469 missense possibly damaging 0.80
R1372:Leo1 UTSW 9 75449469 missense possibly damaging 0.80
R1634:Leo1 UTSW 9 75466260 missense possibly damaging 0.88
R2118:Leo1 UTSW 9 75445812 missense probably damaging 0.99
R2167:Leo1 UTSW 9 75445709 missense probably benign 0.01
R2484:Leo1 UTSW 9 75445473 missense possibly damaging 0.66
R3963:Leo1 UTSW 9 75450480 splice site probably benign
R4628:Leo1 UTSW 9 75445697 missense probably damaging 1.00
R5590:Leo1 UTSW 9 75457141 missense possibly damaging 0.90
R5875:Leo1 UTSW 9 75450560 missense probably damaging 0.98
R6394:Leo1 UTSW 9 75445470 missense probably benign 0.00
R7203:Leo1 UTSW 9 75445996 splice site probably null
R7472:Leo1 UTSW 9 75448341 missense probably damaging 1.00
R7654:Leo1 UTSW 9 75455679 missense possibly damaging 0.66
R7671:Leo1 UTSW 9 75445562 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGAACTCTGACGACGACGAG -3'
(R):5'- CTGCACACAAACAAGAGTAGAG -3'

Sequencing Primer
(F):5'- TCTGACGACGACGAGGAGAAAATG -3'
(R):5'- AACTGGCTGCAACTCCTG -3'
Posted On2016-04-15