Incidental Mutation 'R4935:Uimc1'
ID380319
Institutional Source Beutler Lab
Gene Symbol Uimc1
Ensembl Gene ENSMUSG00000025878
Gene Nameubiquitin interaction motif containing 1
SynonymsD330018D10Rik, D630032M02Rik, Rxrip110, 9430016E08Rik
MMRRC Submission 042535-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.394) question?
Stock #R4935 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location55027880-55100300 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55093185 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 30 (I30T)
Ref Sequence ENSEMBL: ENSMUSP00000097095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026997] [ENSMUST00000099496] [ENSMUST00000127195] [ENSMUST00000148702]
Predicted Effect probably benign
Transcript: ENSMUST00000026997
AA Change: I30T

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000026997
Gene: ENSMUSG00000025878
AA Change: I30T

DomainStartEndE-ValueType
UIM 80 99 7.87e-2 SMART
UIM 105 124 6.73e1 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 388 393 N/A INTRINSIC
low complexity region 714 727 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099496
AA Change: I30T

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097095
Gene: ENSMUSG00000025878
AA Change: I30T

DomainStartEndE-ValueType
UIM 80 99 7.87e-2 SMART
UIM 105 124 1.53e1 SMART
low complexity region 433 446 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124561
Predicted Effect probably benign
Transcript: ENSMUST00000127195
AA Change: I30T

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000122196
Gene: ENSMUSG00000025878
AA Change: I30T

DomainStartEndE-ValueType
UIM 80 99 7.87e-2 SMART
UIM 105 124 6.73e1 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 388 393 N/A INTRINSIC
low complexity region 714 727 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133187
Predicted Effect probably benign
Transcript: ENSMUST00000148702
AA Change: I30T

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000120935
Gene: ENSMUSG00000025878
AA Change: I30T

DomainStartEndE-ValueType
UIM 80 99 7.87e-2 SMART
UIM 105 124 6.73e1 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 388 393 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 86.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that interacts with Brca1 (breast cancer 1) in a complex to recognize and repair DNA lesions. This protein binds ubiquitinated lysine 63 of histone H2A and H2AX. This protein may also function as a repressor of transcription. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death due to B-cell lymphomas and abnormal DNA repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730071L15Rik A G 11: 6,200,442 *138W probably null Het
Abcb1a T A 5: 8,737,773 probably null Het
Acp6 T C 3: 97,171,744 probably null Het
Adcyap1 A T 17: 93,204,113 I172L probably benign Het
Adgrf1 A C 17: 43,295,239 I85L probably benign Het
Afdn A T 17: 13,890,966 T1604S probably benign Het
Angpt2 T C 8: 18,692,115 Y475C probably damaging Het
Ank2 A G 3: 126,956,064 S439P probably damaging Het
Ank3 T A 10: 69,976,203 N366K probably damaging Het
Ankrd11 A G 8: 122,900,183 S87P probably benign Het
Ano7 T A 1: 93,395,314 S459T possibly damaging Het
Asxl3 G A 18: 22,523,312 V1460M probably benign Het
Atg16l1 A C 1: 87,767,042 N147T possibly damaging Het
Atp10a T C 7: 58,813,764 V1015A probably damaging Het
Atxn7 T A 14: 14,100,401 S696T probably benign Het
Babam1 C T 8: 71,399,802 T184I probably benign Het
Blk A G 14: 63,381,262 S175P possibly damaging Het
Col5a1 T A 2: 28,024,742 F123L probably damaging Het
Csmd3 T C 15: 48,161,084 Y496C probably damaging Het
Dnah3 A T 7: 120,016,477 Y1676* probably null Het
Fdxacb1 T A 9: 50,771,943 M402K probably benign Het
Frmd5 A G 2: 121,562,924 V141A possibly damaging Het
Gapvd1 G A 2: 34,704,492 R685* probably null Het
Grik2 A G 10: 49,240,730 L645P probably damaging Het
H2afj T A 6: 136,808,683 V115E possibly damaging Het
Hrh3 T C 2: 180,101,268 Y189C probably damaging Het
Kcnc2 A G 10: 112,272,228 T175A probably benign Het
Kcnv2 A G 19: 27,322,932 Y61C probably damaging Het
Kif24 T C 4: 41,394,939 R645G probably damaging Het
Knl1 A G 2: 119,068,957 I380V possibly damaging Het
Lamb2 A G 9: 108,487,501 I1151M possibly damaging Het
Leo1 A G 9: 75,445,877 D234G probably benign Het
Lrp1b T G 2: 41,498,393 N407H probably benign Het
Matn2 T C 15: 34,428,685 S732P probably damaging Het
Mrps30 A T 13: 118,386,895 F114I possibly damaging Het
Olfr1293-ps G A 2: 111,527,448 V45I probably damaging Het
Olfr1487 T C 19: 13,619,702 I180T probably benign Het
Olfr355 T C 2: 36,927,701 N138D probably benign Het
Oxr1 T C 15: 41,813,584 V179A probably benign Het
Plaur A T 7: 24,466,716 S71C possibly damaging Het
Plbd2 T C 5: 120,486,721 N461D possibly damaging Het
Plcb2 T A 2: 118,718,915 Y322F probably damaging Het
Prkab2 T C 3: 97,662,355 V79A probably damaging Het
Ptpn3 A T 4: 57,197,568 C774S probably damaging Het
Ring1 A C 17: 34,023,042 L131R probably benign Het
Rxfp2 G A 5: 150,051,632 probably null Het
Selenbp1 A T 3: 94,937,958 I122F probably benign Het
Sept7 A G 9: 25,306,172 H394R probably benign Het
Slc1a7 G A 4: 108,007,561 V266I probably damaging Het
Slc2a10 A G 2: 165,517,658 T481A probably benign Het
Tapbp A G 17: 33,925,622 M231V probably benign Het
Tbxas1 A T 6: 39,023,047 N256I probably benign Het
Thegl T C 5: 77,037,353 probably null Het
Usp48 C A 4: 137,650,358 N231K probably benign Het
Zfhx3 T G 8: 108,947,850 V1844G possibly damaging Het
Znrf3 A T 11: 5,283,422 C212S probably damaging Het
Other mutations in Uimc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Uimc1 APN 13 55034911 missense probably benign 0.05
IGL01655:Uimc1 APN 13 55028704 missense probably benign 0.11
IGL01867:Uimc1 APN 13 55075401 missense probably benign
IGL02512:Uimc1 APN 13 55040618 missense possibly damaging 0.66
IGL02704:Uimc1 APN 13 55030959 missense probably benign 0.01
PIT4382001:Uimc1 UTSW 13 55031015 missense probably benign 0.00
PIT4486001:Uimc1 UTSW 13 55075568 missense probably damaging 0.99
R0118:Uimc1 UTSW 13 55085644 missense probably damaging 0.99
R0349:Uimc1 UTSW 13 55075991 missense probably benign 0.11
R0441:Uimc1 UTSW 13 55093219 missense probably damaging 1.00
R0634:Uimc1 UTSW 13 55060266 missense possibly damaging 0.66
R0834:Uimc1 UTSW 13 55076409 critical splice acceptor site probably null
R1175:Uimc1 UTSW 13 55028602 missense possibly damaging 0.92
R2243:Uimc1 UTSW 13 55050739 critical splice donor site probably null
R2566:Uimc1 UTSW 13 55075804 missense probably damaging 1.00
R4435:Uimc1 UTSW 13 55075823 missense probably damaging 0.96
R4622:Uimc1 UTSW 13 55077494 missense probably damaging 1.00
R5140:Uimc1 UTSW 13 55075517 missense probably damaging 1.00
R5466:Uimc1 UTSW 13 55075848 missense probably damaging 1.00
R6395:Uimc1 UTSW 13 55040576 missense possibly damaging 0.66
R6955:Uimc1 UTSW 13 55040546 missense possibly damaging 0.86
R7040:Uimc1 UTSW 13 55075454 intron probably null
R7106:Uimc1 UTSW 13 55050815 missense possibly damaging 0.83
R7505:Uimc1 UTSW 13 55075631 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACGCGCTTTTAAATAATCCAC -3'
(R):5'- ATGGCTGTCATTTGCTCTTATATGACC -3'

Sequencing Primer
(F):5'- GCGCTTTTAAATAATCCACAATTCCC -3'
(R):5'- GCATTTTAGGTAAAAGGATGC -3'
Posted On2016-04-15