Incidental Mutation 'R4935:Atxn7'
ID380321
Institutional Source Beutler Lab
Gene Symbol Atxn7
Ensembl Gene ENSMUSG00000021738
Gene Nameataxin 7
SynonymsA430107N12Rik, ataxin-7, Sca7
MMRRC Submission 042535-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4935 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location13961440-14107302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14100401 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 696 (S696T)
Ref Sequence ENSEMBL: ENSMUSP00000152934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022257] [ENSMUST00000223714] [ENSMUST00000223880]
Predicted Effect probably benign
Transcript: ENSMUST00000022257
AA Change: S696T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022257
Gene: ENSMUSG00000021738
AA Change: S696T

DomainStartEndE-ValueType
low complexity region 13 47 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
ZnF_C2H2 135 157 2.47e1 SMART
low complexity region 174 197 N/A INTRINSIC
low complexity region 202 218 N/A INTRINSIC
Pfam:SCA7 313 381 1.4e-30 PFAM
low complexity region 393 413 N/A INTRINSIC
low complexity region 470 484 N/A INTRINSIC
low complexity region 619 647 N/A INTRINSIC
low complexity region 675 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223714
AA Change: S696T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000223880
AA Change: S696T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223932
Predicted Effect probably benign
Transcript: ENSMUST00000224315
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 86.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the 'pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. This locus has been mapped to chromosome 3, and it has been determined that the diseased allele associated with spinocerebellar ataxia-7 contains 37-306 CAG repeats (near the N-terminus), compared to 4-35 in the normal allele. The encoded protein is a component of the SPT3/TAF9/GCN5 acetyltransferase (STAGA) and TBP-free TAF-containing (TFTC) chromatin remodeling complexes, and it thus plays a role in transcriptional regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Heterozygotes for a targeted mutation with an expanded polyglutamine tract exhibit impaired coordination, ataxia, reduced growth, kyphosis, eye defects, poor reproduction, and high mortality at around 4 months. Homozygotes die at 7-8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730071L15Rik A G 11: 6,200,442 *138W probably null Het
Abcb1a T A 5: 8,737,773 probably null Het
Acp6 T C 3: 97,171,744 probably null Het
Adcyap1 A T 17: 93,204,113 I172L probably benign Het
Adgrf1 A C 17: 43,295,239 I85L probably benign Het
Afdn A T 17: 13,890,966 T1604S probably benign Het
Angpt2 T C 8: 18,692,115 Y475C probably damaging Het
Ank2 A G 3: 126,956,064 S439P probably damaging Het
Ank3 T A 10: 69,976,203 N366K probably damaging Het
Ankrd11 A G 8: 122,900,183 S87P probably benign Het
Ano7 T A 1: 93,395,314 S459T possibly damaging Het
Asxl3 G A 18: 22,523,312 V1460M probably benign Het
Atg16l1 A C 1: 87,767,042 N147T possibly damaging Het
Atp10a T C 7: 58,813,764 V1015A probably damaging Het
Babam1 C T 8: 71,399,802 T184I probably benign Het
Blk A G 14: 63,381,262 S175P possibly damaging Het
Col5a1 T A 2: 28,024,742 F123L probably damaging Het
Csmd3 T C 15: 48,161,084 Y496C probably damaging Het
Dnah3 A T 7: 120,016,477 Y1676* probably null Het
Fdxacb1 T A 9: 50,771,943 M402K probably benign Het
Frmd5 A G 2: 121,562,924 V141A possibly damaging Het
Gapvd1 G A 2: 34,704,492 R685* probably null Het
Grik2 A G 10: 49,240,730 L645P probably damaging Het
H2afj T A 6: 136,808,683 V115E possibly damaging Het
Hrh3 T C 2: 180,101,268 Y189C probably damaging Het
Kcnc2 A G 10: 112,272,228 T175A probably benign Het
Kcnv2 A G 19: 27,322,932 Y61C probably damaging Het
Kif24 T C 4: 41,394,939 R645G probably damaging Het
Knl1 A G 2: 119,068,957 I380V possibly damaging Het
Lamb2 A G 9: 108,487,501 I1151M possibly damaging Het
Leo1 A G 9: 75,445,877 D234G probably benign Het
Lrp1b T G 2: 41,498,393 N407H probably benign Het
Matn2 T C 15: 34,428,685 S732P probably damaging Het
Mrps30 A T 13: 118,386,895 F114I possibly damaging Het
Olfr1293-ps G A 2: 111,527,448 V45I probably damaging Het
Olfr1487 T C 19: 13,619,702 I180T probably benign Het
Olfr355 T C 2: 36,927,701 N138D probably benign Het
Oxr1 T C 15: 41,813,584 V179A probably benign Het
Plaur A T 7: 24,466,716 S71C possibly damaging Het
Plbd2 T C 5: 120,486,721 N461D possibly damaging Het
Plcb2 T A 2: 118,718,915 Y322F probably damaging Het
Prkab2 T C 3: 97,662,355 V79A probably damaging Het
Ptpn3 A T 4: 57,197,568 C774S probably damaging Het
Ring1 A C 17: 34,023,042 L131R probably benign Het
Rxfp2 G A 5: 150,051,632 probably null Het
Selenbp1 A T 3: 94,937,958 I122F probably benign Het
Sept7 A G 9: 25,306,172 H394R probably benign Het
Slc1a7 G A 4: 108,007,561 V266I probably damaging Het
Slc2a10 A G 2: 165,517,658 T481A probably benign Het
Tapbp A G 17: 33,925,622 M231V probably benign Het
Tbxas1 A T 6: 39,023,047 N256I probably benign Het
Thegl T C 5: 77,037,353 probably null Het
Uimc1 A G 13: 55,093,185 I30T probably damaging Het
Usp48 C A 4: 137,650,358 N231K probably benign Het
Zfhx3 T G 8: 108,947,850 V1844G possibly damaging Het
Znrf3 A T 11: 5,283,422 C212S probably damaging Het
Other mutations in Atxn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Atxn7 APN 14 14096324 splice site probably benign
IGL00782:Atxn7 APN 14 14096218 missense possibly damaging 0.78
IGL01405:Atxn7 APN 14 14100105 missense probably benign 0.00
IGL02828:Atxn7 APN 14 14090056 missense probably damaging 1.00
IGL03119:Atxn7 APN 14 14100734 missense probably damaging 1.00
IGL03139:Atxn7 APN 14 14052994 missense probably damaging 0.97
IGL03282:Atxn7 APN 14 14100564 missense probably damaging 0.99
IGL03387:Atxn7 APN 14 14087273 splice site probably benign
Estes_park UTSW 14 14096317 critical splice donor site probably null
Lumpy UTSW 14 14089446 nonsense probably null
Oestes_park UTSW 14 14096268 nonsense probably null
R0034:Atxn7 UTSW 14 14100846 missense probably damaging 0.96
R0408:Atxn7 UTSW 14 14100317 missense probably damaging 1.00
R0853:Atxn7 UTSW 14 14089465 splice site probably benign
R1169:Atxn7 UTSW 14 14095468 missense possibly damaging 0.81
R1678:Atxn7 UTSW 14 14096239 missense probably damaging 1.00
R1802:Atxn7 UTSW 14 14089419 missense probably benign 0.25
R2078:Atxn7 UTSW 14 14052975 missense probably damaging 0.99
R2275:Atxn7 UTSW 14 14013268 missense possibly damaging 0.85
R2394:Atxn7 UTSW 14 14100237 missense probably damaging 1.00
R4118:Atxn7 UTSW 14 14100308 missense probably benign 0.00
R4230:Atxn7 UTSW 14 14100381 missense probably benign 0.00
R4588:Atxn7 UTSW 14 14096268 nonsense probably null
R4688:Atxn7 UTSW 14 14089288 missense probably benign 0.00
R5041:Atxn7 UTSW 14 14096317 critical splice donor site probably null
R5185:Atxn7 UTSW 14 14090063 missense probably benign 0.04
R5561:Atxn7 UTSW 14 14089260 missense probably benign 0.19
R5641:Atxn7 UTSW 14 14013638 missense probably damaging 0.99
R6490:Atxn7 UTSW 14 14089446 nonsense probably null
R6549:Atxn7 UTSW 14 14013087 missense probably damaging 0.99
R6623:Atxn7 UTSW 14 14099972 missense probably damaging 1.00
R6950:Atxn7 UTSW 14 14095511 missense probably damaging 1.00
R7054:Atxn7 UTSW 14 14100878 missense probably benign 0.08
R7402:Atxn7 UTSW 14 14095427 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GACAAGTGTCGGCTTCATCCTC -3'
(R):5'- CATCCTCTTGATGGGCTCTG -3'

Sequencing Primer
(F):5'- GTCGGCTTCATCCTCACCCC -3'
(R):5'- CCTCTTGATGGGCTCTGCAGAG -3'
Posted On2016-04-15