Incidental Mutation 'R4935:Matn2'
ID380323
Institutional Source Beutler Lab
Gene Symbol Matn2
Ensembl Gene ENSMUSG00000022324
Gene Namematrilin 2
SynonymsCrtm2
MMRRC Submission 042535-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4935 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location34306677-34436273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34428685 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 732 (S732P)
Ref Sequence ENSEMBL: ENSMUSP00000154572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022947] [ENSMUST00000163455] [ENSMUST00000227759] [ENSMUST00000228570]
Predicted Effect probably damaging
Transcript: ENSMUST00000022947
AA Change: S732P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022947
Gene: ENSMUSG00000022324
AA Change: S732P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 55 237 1.99e-49 SMART
EGF 241 278 6.86e-4 SMART
EGF 282 319 5.49e-3 SMART
EGF 323 360 7.88e-4 SMART
EGF 364 401 6.76e-3 SMART
EGF 405 442 4.39e-2 SMART
EGF 446 483 9.41e-2 SMART
EGF 487 524 1.24e-1 SMART
EGF 528 565 2.23e-3 SMART
EGF 569 606 8.44e-4 SMART
EGF 610 647 9.55e-3 SMART
VWA 653 831 1.14e-49 SMART
Matrilin_ccoil 889 935 4.78e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163455
AA Change: S732P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128202
Gene: ENSMUSG00000022324
AA Change: S732P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 55 237 1.99e-49 SMART
EGF 241 278 6.86e-4 SMART
EGF 282 319 5.49e-3 SMART
EGF 323 360 7.88e-4 SMART
EGF 364 401 6.76e-3 SMART
EGF 405 442 4.39e-2 SMART
EGF 446 483 9.41e-2 SMART
EGF 487 524 1.24e-1 SMART
EGF 528 565 2.23e-3 SMART
EGF 569 606 8.44e-4 SMART
EGF 610 647 9.55e-3 SMART
VWA 653 831 1.14e-49 SMART
Matrilin_ccoil 908 955 7.77e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000227759
AA Change: S732P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000228570
AA Change: S732P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 86.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This protein contains five von Willebrand factor A domains. The specific function of this gene has not yet been determined. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile with no obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730071L15Rik A G 11: 6,200,442 *138W probably null Het
Abcb1a T A 5: 8,737,773 probably null Het
Acp6 T C 3: 97,171,744 probably null Het
Adcyap1 A T 17: 93,204,113 I172L probably benign Het
Adgrf1 A C 17: 43,295,239 I85L probably benign Het
Afdn A T 17: 13,890,966 T1604S probably benign Het
Angpt2 T C 8: 18,692,115 Y475C probably damaging Het
Ank2 A G 3: 126,956,064 S439P probably damaging Het
Ank3 T A 10: 69,976,203 N366K probably damaging Het
Ankrd11 A G 8: 122,900,183 S87P probably benign Het
Ano7 T A 1: 93,395,314 S459T possibly damaging Het
Asxl3 G A 18: 22,523,312 V1460M probably benign Het
Atg16l1 A C 1: 87,767,042 N147T possibly damaging Het
Atp10a T C 7: 58,813,764 V1015A probably damaging Het
Atxn7 T A 14: 14,100,401 S696T probably benign Het
Babam1 C T 8: 71,399,802 T184I probably benign Het
Blk A G 14: 63,381,262 S175P possibly damaging Het
Col5a1 T A 2: 28,024,742 F123L probably damaging Het
Csmd3 T C 15: 48,161,084 Y496C probably damaging Het
Dnah3 A T 7: 120,016,477 Y1676* probably null Het
Fdxacb1 T A 9: 50,771,943 M402K probably benign Het
Frmd5 A G 2: 121,562,924 V141A possibly damaging Het
Gapvd1 G A 2: 34,704,492 R685* probably null Het
Grik2 A G 10: 49,240,730 L645P probably damaging Het
H2afj T A 6: 136,808,683 V115E possibly damaging Het
Hrh3 T C 2: 180,101,268 Y189C probably damaging Het
Kcnc2 A G 10: 112,272,228 T175A probably benign Het
Kcnv2 A G 19: 27,322,932 Y61C probably damaging Het
Kif24 T C 4: 41,394,939 R645G probably damaging Het
Knl1 A G 2: 119,068,957 I380V possibly damaging Het
Lamb2 A G 9: 108,487,501 I1151M possibly damaging Het
Leo1 A G 9: 75,445,877 D234G probably benign Het
Lrp1b T G 2: 41,498,393 N407H probably benign Het
Mrps30 A T 13: 118,386,895 F114I possibly damaging Het
Olfr1293-ps G A 2: 111,527,448 V45I probably damaging Het
Olfr1487 T C 19: 13,619,702 I180T probably benign Het
Olfr355 T C 2: 36,927,701 N138D probably benign Het
Oxr1 T C 15: 41,813,584 V179A probably benign Het
Plaur A T 7: 24,466,716 S71C possibly damaging Het
Plbd2 T C 5: 120,486,721 N461D possibly damaging Het
Plcb2 T A 2: 118,718,915 Y322F probably damaging Het
Prkab2 T C 3: 97,662,355 V79A probably damaging Het
Ptpn3 A T 4: 57,197,568 C774S probably damaging Het
Ring1 A C 17: 34,023,042 L131R probably benign Het
Rxfp2 G A 5: 150,051,632 probably null Het
Selenbp1 A T 3: 94,937,958 I122F probably benign Het
Sept7 A G 9: 25,306,172 H394R probably benign Het
Slc1a7 G A 4: 108,007,561 V266I probably damaging Het
Slc2a10 A G 2: 165,517,658 T481A probably benign Het
Tapbp A G 17: 33,925,622 M231V probably benign Het
Tbxas1 A T 6: 39,023,047 N256I probably benign Het
Thegl T C 5: 77,037,353 probably null Het
Uimc1 A G 13: 55,093,185 I30T probably damaging Het
Usp48 C A 4: 137,650,358 N231K probably benign Het
Zfhx3 T G 8: 108,947,850 V1844G possibly damaging Het
Znrf3 A T 11: 5,283,422 C212S probably damaging Het
Other mutations in Matn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Matn2 APN 15 34428470 missense probably damaging 1.00
IGL00392:Matn2 APN 15 34402856 missense probably benign 0.00
IGL01475:Matn2 APN 15 34316525 missense possibly damaging 0.94
IGL02223:Matn2 APN 15 34423718 missense probably benign 0.00
IGL02252:Matn2 APN 15 34316590 missense probably damaging 0.98
IGL02288:Matn2 APN 15 34422386 missense probably damaging 1.00
IGL02738:Matn2 APN 15 34388739 missense probably benign 0.07
IGL02927:Matn2 APN 15 34355655 missense probably damaging 1.00
IGL03331:Matn2 APN 15 34345357 missense probably damaging 1.00
Engorged UTSW 15 34426234 missense probably damaging 1.00
PIT4260001:Matn2 UTSW 15 34428731 missense possibly damaging 0.78
R0124:Matn2 UTSW 15 34426151 splice site probably benign
R0422:Matn2 UTSW 15 34435771 unclassified probably null
R0449:Matn2 UTSW 15 34428541 missense probably damaging 1.00
R0606:Matn2 UTSW 15 34345150 missense probably damaging 1.00
R0655:Matn2 UTSW 15 34345200 missense probably benign 0.03
R0885:Matn2 UTSW 15 34316605 missense possibly damaging 0.67
R1384:Matn2 UTSW 15 34409810 missense probably benign 0.00
R1603:Matn2 UTSW 15 34388768 missense probably damaging 1.00
R1667:Matn2 UTSW 15 34378732 missense probably damaging 0.99
R1720:Matn2 UTSW 15 34345274 nonsense probably null
R1772:Matn2 UTSW 15 34428785 missense probably damaging 0.99
R2037:Matn2 UTSW 15 34433117 missense probably benign 0.00
R2107:Matn2 UTSW 15 34423759 missense probably damaging 1.00
R2240:Matn2 UTSW 15 34433063 missense probably damaging 1.00
R3933:Matn2 UTSW 15 34345420 unclassified probably null
R3963:Matn2 UTSW 15 34388791 nonsense probably null
R4648:Matn2 UTSW 15 34428533 missense probably damaging 1.00
R4695:Matn2 UTSW 15 34402925 missense probably damaging 1.00
R4817:Matn2 UTSW 15 34423799 missense probably damaging 1.00
R5105:Matn2 UTSW 15 34355668 missense possibly damaging 0.95
R5177:Matn2 UTSW 15 34433514 missense possibly damaging 0.58
R5717:Matn2 UTSW 15 34399091 nonsense probably null
R5760:Matn2 UTSW 15 34355607 missense possibly damaging 0.46
R5776:Matn2 UTSW 15 34431619 missense probably damaging 1.00
R5842:Matn2 UTSW 15 34399056 missense probably damaging 0.99
R5917:Matn2 UTSW 15 34409766 nonsense probably null
R5964:Matn2 UTSW 15 34410165 missense probably damaging 1.00
R6265:Matn2 UTSW 15 34399155 missense probably damaging 1.00
R6272:Matn2 UTSW 15 34355607 missense possibly damaging 0.46
R6332:Matn2 UTSW 15 34423755 missense probably benign 0.00
R6457:Matn2 UTSW 15 34426234 missense probably damaging 1.00
R7351:Matn2 UTSW 15 34345336 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTGTGAAGCACTTTGTCACTGG -3'
(R):5'- CAGCTGTGAATCTAAAAGACCC -3'

Sequencing Primer
(F):5'- GCACTTTGTCACTGGAATCATAG -3'
(R):5'- GTGAATCTAAAAGACCCAAACTTTG -3'
Posted On2016-04-15