Mutagenetix > Incidental Mutations

Incidental Mutation 'R4935:Adgrf1'

380330

Institutional Source

Beutler Lab

Gene Symbol

Adgrf1

Ensembl Gene

ENSMUSG00000041293

Gene Name

adhesion G protein-coupled receptor F1

Synonyms

Gpr110, 5031409J19Rik

MMRRC Submission

042535-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4935 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43270329-43324737 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 43295239 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 85 (I85L)

Ref Sequence

ENSEMBL: ENSMUSP00000049380 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047399]

Predicted Effect

probably benign
Transcript: ENSMUST00000047399
AA Change: I85L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000049380
Gene: ENSMUSG00000041293
AA Change: I85L

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
low complexity region	59	83	N/A	INTRINSIC
Pfam:SEA	150	238	3.7e-10	PFAM
low complexity region	341	363	N/A	INTRINSIC
GPS	528	576	5.56e-15	SMART
Pfam:7tm_2	580	832	2.1e-38	PFAM

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 94.8%
20x: 86.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a reporter allele exhibit normal viability and fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730071L15Rik	A	G	11: 6,200,442	*138W	probably null	Het
Abcb1a	T	A	5: 8,737,773		probably null	Het
Acp6	T	C	3: 97,171,744		probably null	Het
Adcyap1	A	T	17: 93,204,113	I172L	probably benign	Het
Afdn	A	T	17: 13,890,966	T1604S	probably benign	Het
Angpt2	T	C	8: 18,692,115	Y475C	probably damaging	Het
Ank2	A	G	3: 126,956,064	S439P	probably damaging	Het
Ank3	T	A	10: 69,976,203	N366K	probably damaging	Het
Ankrd11	A	G	8: 122,900,183	S87P	probably benign	Het
Ano7	T	A	1: 93,395,314	S459T	possibly damaging	Het
Asxl3	G	A	18: 22,523,312	V1460M	probably benign	Het
Atg16l1	A	C	1: 87,767,042	N147T	possibly damaging	Het
Atp10a	T	C	7: 58,813,764	V1015A	probably damaging	Het
Atxn7	T	A	14: 14,100,401	S696T	probably benign	Het
Babam1	C	T	8: 71,399,802	T184I	probably benign	Het
Blk	A	G	14: 63,381,262	S175P	possibly damaging	Het
Col5a1	T	A	2: 28,024,742	F123L	probably damaging	Het
Csmd3	T	C	15: 48,161,084	Y496C	probably damaging	Het
Dnah3	A	T	7: 120,016,477	Y1676*	probably null	Het
Fdxacb1	T	A	9: 50,771,943	M402K	probably benign	Het
Frmd5	A	G	2: 121,562,924	V141A	possibly damaging	Het
Gapvd1	G	A	2: 34,704,492	R685*	probably null	Het
Grik2	A	G	10: 49,240,730	L645P	probably damaging	Het
H2afj	T	A	6: 136,808,683	V115E	possibly damaging	Het
Hrh3	T	C	2: 180,101,268	Y189C	probably damaging	Het
Kcnc2	A	G	10: 112,272,228	T175A	probably benign	Het
Kcnv2	A	G	19: 27,322,932	Y61C	probably damaging	Het
Kif24	T	C	4: 41,394,939	R645G	probably damaging	Het
Knl1	A	G	2: 119,068,957	I380V	possibly damaging	Het
Lamb2	A	G	9: 108,487,501	I1151M	possibly damaging	Het
Leo1	A	G	9: 75,445,877	D234G	probably benign	Het
Lrp1b	T	G	2: 41,498,393	N407H	probably benign	Het
Matn2	T	C	15: 34,428,685	S732P	probably damaging	Het
Mrps30	A	T	13: 118,386,895	F114I	possibly damaging	Het
Olfr1293-ps	G	A	2: 111,527,448	V45I	probably damaging	Het
Olfr1487	T	C	19: 13,619,702	I180T	probably benign	Het
Olfr355	T	C	2: 36,927,701	N138D	probably benign	Het
Oxr1	T	C	15: 41,813,584	V179A	probably benign	Het
Plaur	A	T	7: 24,466,716	S71C	possibly damaging	Het
Plbd2	T	C	5: 120,486,721	N461D	possibly damaging	Het
Plcb2	T	A	2: 118,718,915	Y322F	probably damaging	Het
Prkab2	T	C	3: 97,662,355	V79A	probably damaging	Het
Ptpn3	A	T	4: 57,197,568	C774S	probably damaging	Het
Ring1	A	C	17: 34,023,042	L131R	probably benign	Het
Rxfp2	G	A	5: 150,051,632		probably null	Het
Selenbp1	A	T	3: 94,937,958	I122F	probably benign	Het
Sept7	A	G	9: 25,306,172	H394R	probably benign	Het
Slc1a7	G	A	4: 108,007,561	V266I	probably damaging	Het
Slc2a10	A	G	2: 165,517,658	T481A	probably benign	Het
Tapbp	A	G	17: 33,925,622	M231V	probably benign	Het
Tbxas1	A	T	6: 39,023,047	N256I	probably benign	Het
Thegl	T	C	5: 77,037,353		probably null	Het
Uimc1	A	G	13: 55,093,185	I30T	probably damaging	Het
Usp48	C	A	4: 137,650,358	N231K	probably benign	Het
Zfhx3	T	G	8: 108,947,850	V1844G	possibly damaging	Het
Znrf3	A	T	11: 5,283,422	C212S	probably damaging	Het

Other mutations in Adgrf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01343:Adgrf1	APN	17	43313195	missense	probably null	0.92
IGL01359:Adgrf1	APN	17	43310686	missense	probably damaging	0.99
IGL02131:Adgrf1	APN	17	43303747	missense	probably damaging	0.99
IGL02692:Adgrf1	APN	17	43303778	missense	probably damaging	1.00
IGL02891:Adgrf1	APN	17	43311161	missense	probably damaging	0.96
IGL03027:Adgrf1	APN	17	43296714	missense	probably damaging	1.00
IGL03296:Adgrf1	APN	17	43321153	splice site	probably benign
R0211:Adgrf1	UTSW	17	43296690	missense	probably damaging	1.00
R0211:Adgrf1	UTSW	17	43296690	missense	probably damaging	1.00
R0389:Adgrf1	UTSW	17	43303788	critical splice donor site	probably null
R0488:Adgrf1	UTSW	17	43310411	missense	probably damaging	0.99
R1591:Adgrf1	UTSW	17	43310981	missense	probably damaging	1.00
R1817:Adgrf1	UTSW	17	43310033	missense	probably benign	0.01
R1819:Adgrf1	UTSW	17	43310033	missense	probably benign	0.01
R2009:Adgrf1	UTSW	17	43321221	nonsense	probably null
R2032:Adgrf1	UTSW	17	43311275	missense	probably damaging	1.00
R2140:Adgrf1	UTSW	17	43300802	missense	probably damaging	0.99
R3953:Adgrf1	UTSW	17	43310207	missense	probably benign	0.08
R4679:Adgrf1	UTSW	17	43310493	missense	probably damaging	1.00
R4775:Adgrf1	UTSW	17	43311163	missense	probably damaging	1.00
R4858:Adgrf1	UTSW	17	43303672	missense	probably damaging	1.00
R4894:Adgrf1	UTSW	17	43299084	nonsense	probably null
R4895:Adgrf1	UTSW	17	43310620	missense	probably benign	0.33
R5027:Adgrf1	UTSW	17	43303747	missense	probably damaging	0.99
R5373:Adgrf1	UTSW	17	43291005	start gained	probably benign
R5374:Adgrf1	UTSW	17	43291005	start gained	probably benign
R5455:Adgrf1	UTSW	17	43321143	splice site	probably null
R5579:Adgrf1	UTSW	17	43311064	missense	probably damaging	1.00
R5985:Adgrf1	UTSW	17	43293255	missense	probably benign	0.00
R6038:Adgrf1	UTSW	17	43295209	missense	probably benign	0.00
R6038:Adgrf1	UTSW	17	43295209	missense	probably benign	0.00
R6160:Adgrf1	UTSW	17	43310687	missense	probably damaging	1.00
R6227:Adgrf1	UTSW	17	43310273	missense	probably benign	0.05
R6500:Adgrf1	UTSW	17	43310372	missense	probably damaging	1.00
R7066:Adgrf1	UTSW	17	43310260	missense	probably benign	0.05
R7099:Adgrf1	UTSW	17	43310602	missense	probably benign	0.00
R7561:Adgrf1	UTSW	17	43311109	missense	possibly damaging	0.94
R8359:Adgrf1	UTSW	17	43310395	missense	probably damaging	0.99
R8480:Adgrf1	UTSW	17	43295164	missense	probably benign	0.08
R8543:Adgrf1	UTSW	17	43313206	missense	probably null	0.99
Z1177:Adgrf1	UTSW	17	43310147	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- AAGTGATCCTCCCCATAGACG -3'
(R):5'- GATTGAACTTCGCGGGGAAC -3'

Sequencing Primer
(F):5'- TGATCCTCCCCATAGACGGGTAC -3'
(R):5'- CCAAAGAATGTCACTGCCTGTGTG -3'

Posted On

2016-04-15