Incidental Mutation 'R4935:Kcnv2'
ID380334
Institutional Source Beutler Lab
Gene Symbol Kcnv2
Ensembl Gene ENSMUSG00000047298
Gene Namepotassium channel, subfamily V, member 2
SynonymsKV11.1
MMRRC Submission 042535-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4935 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location27322588-27337179 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27322932 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 61 (Y61C)
Ref Sequence ENSEMBL: ENSMUSP00000055091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056708]
Predicted Effect probably damaging
Transcript: ENSMUST00000056708
AA Change: Y61C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055091
Gene: ENSMUSG00000047298
AA Change: Y61C

DomainStartEndE-ValueType
low complexity region 64 79 N/A INTRINSIC
Pfam:BTB_2 107 206 3.1e-22 PFAM
low complexity region 225 240 N/A INTRINSIC
Pfam:Ion_trans 269 521 2.2e-39 PFAM
Pfam:PKD_channel 305 516 2.5e-7 PFAM
Pfam:Ion_trans_2 430 515 2.2e-15 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 86.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium voltage-gated channel subfamily V. This member is identified as a 'silent subunit', and it does not form homomultimers, but forms heteromultimers with several other subfamily members. Through obligatory heteromerization, it exerts a function-altering effect on other potassium channel subunits. This protein is strongly expressed in pancreas and has a weaker expression in several other tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional ready allele are viable, fertile, and phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730071L15Rik A G 11: 6,200,442 *138W probably null Het
Abcb1a T A 5: 8,737,773 probably null Het
Acp6 T C 3: 97,171,744 probably null Het
Adcyap1 A T 17: 93,204,113 I172L probably benign Het
Adgrf1 A C 17: 43,295,239 I85L probably benign Het
Afdn A T 17: 13,890,966 T1604S probably benign Het
Angpt2 T C 8: 18,692,115 Y475C probably damaging Het
Ank2 A G 3: 126,956,064 S439P probably damaging Het
Ank3 T A 10: 69,976,203 N366K probably damaging Het
Ankrd11 A G 8: 122,900,183 S87P probably benign Het
Ano7 T A 1: 93,395,314 S459T possibly damaging Het
Asxl3 G A 18: 22,523,312 V1460M probably benign Het
Atg16l1 A C 1: 87,767,042 N147T possibly damaging Het
Atp10a T C 7: 58,813,764 V1015A probably damaging Het
Atxn7 T A 14: 14,100,401 S696T probably benign Het
Babam1 C T 8: 71,399,802 T184I probably benign Het
Blk A G 14: 63,381,262 S175P possibly damaging Het
Col5a1 T A 2: 28,024,742 F123L probably damaging Het
Csmd3 T C 15: 48,161,084 Y496C probably damaging Het
Dnah3 A T 7: 120,016,477 Y1676* probably null Het
Fdxacb1 T A 9: 50,771,943 M402K probably benign Het
Frmd5 A G 2: 121,562,924 V141A possibly damaging Het
Gapvd1 G A 2: 34,704,492 R685* probably null Het
Grik2 A G 10: 49,240,730 L645P probably damaging Het
H2afj T A 6: 136,808,683 V115E possibly damaging Het
Hrh3 T C 2: 180,101,268 Y189C probably damaging Het
Kcnc2 A G 10: 112,272,228 T175A probably benign Het
Kif24 T C 4: 41,394,939 R645G probably damaging Het
Knl1 A G 2: 119,068,957 I380V possibly damaging Het
Lamb2 A G 9: 108,487,501 I1151M possibly damaging Het
Leo1 A G 9: 75,445,877 D234G probably benign Het
Lrp1b T G 2: 41,498,393 N407H probably benign Het
Matn2 T C 15: 34,428,685 S732P probably damaging Het
Mrps30 A T 13: 118,386,895 F114I possibly damaging Het
Olfr1293-ps G A 2: 111,527,448 V45I probably damaging Het
Olfr1487 T C 19: 13,619,702 I180T probably benign Het
Olfr355 T C 2: 36,927,701 N138D probably benign Het
Oxr1 T C 15: 41,813,584 V179A probably benign Het
Plaur A T 7: 24,466,716 S71C possibly damaging Het
Plbd2 T C 5: 120,486,721 N461D possibly damaging Het
Plcb2 T A 2: 118,718,915 Y322F probably damaging Het
Prkab2 T C 3: 97,662,355 V79A probably damaging Het
Ptpn3 A T 4: 57,197,568 C774S probably damaging Het
Ring1 A C 17: 34,023,042 L131R probably benign Het
Rxfp2 G A 5: 150,051,632 probably null Het
Selenbp1 A T 3: 94,937,958 I122F probably benign Het
Sept7 A G 9: 25,306,172 H394R probably benign Het
Slc1a7 G A 4: 108,007,561 V266I probably damaging Het
Slc2a10 A G 2: 165,517,658 T481A probably benign Het
Tapbp A G 17: 33,925,622 M231V probably benign Het
Tbxas1 A T 6: 39,023,047 N256I probably benign Het
Thegl T C 5: 77,037,353 probably null Het
Uimc1 A G 13: 55,093,185 I30T probably damaging Het
Usp48 C A 4: 137,650,358 N231K probably benign Het
Zfhx3 T G 8: 108,947,850 V1844G possibly damaging Het
Znrf3 A T 11: 5,283,422 C212S probably damaging Het
Other mutations in Kcnv2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03157:Kcnv2 APN 19 27323966 missense probably damaging 1.00
R0104:Kcnv2 UTSW 19 27323219 missense probably damaging 0.98
R0319:Kcnv2 UTSW 19 27324024 missense probably benign 0.25
R2852:Kcnv2 UTSW 19 27323096 missense probably benign 0.13
R4578:Kcnv2 UTSW 19 27323594 missense probably benign 0.01
R4702:Kcnv2 UTSW 19 27323567 missense probably damaging 1.00
R4842:Kcnv2 UTSW 19 27323790 missense probably damaging 1.00
R6305:Kcnv2 UTSW 19 27323837 missense probably benign 0.01
R6577:Kcnv2 UTSW 19 27324020 missense possibly damaging 0.46
R6974:Kcnv2 UTSW 19 27333882 missense probably benign
R7113:Kcnv2 UTSW 19 27324048 missense probably damaging 1.00
R7289:Kcnv2 UTSW 19 27333684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTAAAACAGTGCAGGGCAG -3'
(R):5'- ACAGCATTCCAGCAGATAGC -3'

Sequencing Primer
(F):5'- TACTCTCCAGGGGCCATAGACAG -3'
(R):5'- AGATAGCTGTGGCCGCCTAC -3'
Posted On2016-04-15