Mutagenetix > Incidental Mutation

Incidental Mutation 'R4936:Tln1'

380355

Institutional Source

Beutler Lab

Gene Symbol

Tln1

Ensembl Gene

ENSMUSG00000028465

Gene Name

talin 1

Synonyms

MMRRC Submission

042536-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4936 (G1)

Quality Score

215

Status

Not validated

Chromosome

Chromosomal Location

43531519-43562691 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 43547522 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 813 (F813S)

Ref Sequence

ENSEMBL: ENSMUSP00000030187 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030187]

AlphaFold

P26039

PDB Structure

Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION]
Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION]
Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION]
Solution structure of VBS2 fragment of talin [SOLUTION NMR]
Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION]
Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION]
Solution structure of VBS3 fragment of talin [SOLUTION NMR]
NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR]
NMR structure of the talin C-terminal actin binding site [SOLUTION NMR]
NMR structure of the talin rod domain, 1655-1822 [SOLUTION NMR]
>> 16 additional structures at PDB <<

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030187
AA Change: F813S

PolyPhen 2 Score 0.833 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465
AA Change: F813S

Domain	Start	End	E-Value	Type
Blast:B41	2	76	5e-31	BLAST
B41	82	313	4.66e-73	SMART
IRS	308	401	7.65e-16	SMART
Pfam:Talin_middle	491	652	8.2e-60	PFAM
low complexity region	671	690	N/A	INTRINSIC
internal_repeat_2	699	760	8.94e-6	PROSPERO
low complexity region	766	775	N/A	INTRINSIC
PDB:1ZVZ\|B	820	844	2e-7	PDB
low complexity region	866	879	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
PDB:2LQG\|A	913	1044	2e-44	PDB
PDB:2L7N\|A	1046	1207	1e-101	PDB
Pfam:VBS	1234	1358	9.6e-8	PFAM
internal_repeat_2	1488	1549	8.94e-6	PROSPERO
internal_repeat_3	1623	1769	4.92e-5	PROSPERO
low complexity region	1817	1828	N/A	INTRINSIC
Pfam:VBS	1849	1973	6.2e-67	PFAM
PDB:3DYJ\|B	1974	2293	N/A	PDB
low complexity region	2305	2327	N/A	INTRINSIC
ILWEQ	2336	2533	2.93e-105	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000125509
AA Change: F240S

SMART Domains

Protein: ENSMUSP00000115681
Gene: ENSMUSG00000028465
AA Change: F240S

Domain	Start	End	E-Value	Type
Blast:IRS	2	28	2e-9	BLAST
PDB:2G35\|A	2	29	3e-11	PDB
Pfam:Talin_middle	32	193	1.8e-61	PFAM
PDB:2L7A\|A	215	279	1e-38	PDB

Predicted Effect

unknown
Transcript: ENSMUST00000134623
AA Change: F42S

SMART Domains

Protein: ENSMUSP00000119956
Gene: ENSMUSG00000028465
AA Change: F42S

Domain	Start	End	E-Value	Type
PDB:1U89\|A	2	106	9e-50	PDB
low complexity region	107	120	N/A	INTRINSIC

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.0%
20x: 87.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300002M23Rik	T	A	17: 35,568,315	F183L	possibly damaging	Het
4930590J08Rik	T	A	6: 91,944,264	M775K	probably damaging	Het
Actn1	T	G	12: 80,172,998	I700L	probably benign	Het
Adam5	T	C	8: 24,786,271	Y460C	probably damaging	Het
Akna	C	T	4: 63,395,265	G207E	probably damaging	Het
Ank2	T	A	3: 126,955,039	H527L	possibly damaging	Het
Anks1	C	A	17: 27,988,805	N383K	probably damaging	Het
Apba3	C	T	10: 81,269,370		probably null	Het
Atp9b	C	A	18: 80,736,093	V1121F	possibly damaging	Het
Bsn	T	C	9: 108,111,761	Y2264C	probably damaging	Het
Bst1	A	G	5: 43,840,457	D266G	probably damaging	Het
Cep55	A	G	19: 38,071,754		probably null	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Ckb	T	C	12: 111,671,230	K156E	probably benign	Het
Cln3	T	A	7: 126,575,221	H315L	probably damaging	Het
Cnot6l	A	G	5: 96,079,937	F479S	probably damaging	Het
Col1a1	A	G	11: 94,947,132	D826G	unknown	Het
Cyp27a1	T	C	1: 74,735,405	V194A	probably benign	Het
Dis3l2	C	T	1: 87,044,168	P643S	probably benign	Het
Dpf3	T	C	12: 83,331,966	D108G	probably damaging	Het
Eif2b4	C	T	5: 31,192,897	G27D	probably benign	Het
Eif4a1	T	G	11: 69,672,425		probably benign	Het
Espl1	A	T	15: 102,304,937	D566V	probably damaging	Het
Ext2	T	A	2: 93,813,679	R86*	probably null	Het
Fasn	A	T	11: 120,816,085	F914I	probably damaging	Het
Fbf1	A	G	11: 116,152,552	L477P	probably benign	Het
Fsd1	A	T	17: 55,996,452	K441N	possibly damaging	Het
Fsip2	T	A	2: 82,985,040	S3706T	probably benign	Het
Gabra5	A	T	7: 57,408,799	N400K	probably benign	Het
Gimap8	G	T	6: 48,656,134	G296W	probably damaging	Het
Gli2	A	G	1: 118,836,140	V1427A	probably benign	Het
Gm7334	A	T	17: 50,698,827	Y47F	probably damaging	Het
Gm8674	T	G	13: 49,900,755		noncoding transcript	Het
Gmeb2	G	T	2: 181,254,246	T377K	probably benign	Het
Gp9	T	A	6: 87,779,247	D81E	probably benign	Het
Il5ra	T	A	6: 106,738,162	I212F	possibly damaging	Het
Klhl18	G	T	9: 110,428,961	N470K	possibly damaging	Het
Lfng	G	T	5: 140,612,395		probably null	Het
Lpo	A	G	11: 87,810,340	I430T	probably benign	Het
Lrrc31	C	T	3: 30,689,268	D183N	probably damaging	Het
Meis2	T	C	2: 115,864,412	T410A	probably benign	Het
Myo6	A	G	9: 80,307,681	D1232G	probably damaging	Het
Ncapd2	C	T	6: 125,169,840	R1261H	probably benign	Het
Nfkb1	C	T	3: 135,613,982	V251M	probably damaging	Het
Nmbr	C	A	10: 14,766,986	H96Q	probably damaging	Het
Nop14	C	T	5: 34,652,393	R256H	probably damaging	Het
Nqo2	T	A	13: 33,981,518	Y133N	probably damaging	Het
Olfr1153	A	G	2: 87,896,813	I213V	probably benign	Het
Olfr1366	T	C	13: 21,537,187	I273V	probably benign	Het
Pbld2	C	A	10: 63,052,238	S168R	probably damaging	Het
Pcdhb7	G	T	18: 37,342,149	G113*	probably null	Het
Pcdhb7	G	T	18: 37,342,150	G113V	probably damaging	Het
Pdgfra	A	T	5: 75,195,026	T1066S	probably damaging	Het
Prdm8	A	T	5: 98,185,022		probably null	Het
Prdm8	G	T	5: 98,185,023		probably null	Het
Prkg1	T	C	19: 30,586,375	Y479C	probably benign	Het
Pudp	T	C	18: 50,568,468	T65A	probably benign	Het
Rbbp6	C	T	7: 122,999,703		probably benign	Het
Rcc1	C	G	4: 132,335,735	V187L	probably damaging	Het
Rims2	T	A	15: 39,437,728	M285K	probably damaging	Het
Rtkn2	T	C	10: 68,041,915	*602Q	probably null	Het
Rxfp3	T	G	15: 11,036,780	S169R	probably damaging	Het
Sardh	T	C	2: 27,228,241		probably null	Het
Slc24a2	A	T	4: 87,227,347	F157I	probably damaging	Het
Slc25a20	T	C	9: 108,681,992	Y186H	probably damaging	Het
Slc25a24	A	G	3: 109,163,548	R408G	probably damaging	Het
Slc44a5	T	G	3: 154,253,716	I348S	probably damaging	Het
Slc8a2	A	T	7: 16,134,175	K111*	probably null	Het
Smc5	A	G	19: 23,234,003	V589A	probably damaging	Het
Thbd	A	T	2: 148,407,735	I71N	probably damaging	Het
Thsd7b	T	C	1: 129,678,145	M541T	probably benign	Het
Tie1	T	A	4: 118,484,771		silent	Het
Tnrc18	A	T	5: 142,765,977	L1191*	probably null	Het
Tubb2a	A	C	13: 34,075,257	Y183*	probably null	Het
Ubr4	T	A	4: 139,396,566	V343E	probably damaging	Het
Vmn2r93	A	T	17: 18,304,065	D107V	possibly damaging	Het
Vwa5a	T	G	9: 38,736,198	S624R	probably benign	Het
Wwox	G	A	8: 114,706,358	V255I	probably benign	Het
Wwp1	T	C	4: 19,638,804	K546E	probably damaging	Het
Xirp2	T	A	2: 67,509,819	F801L	possibly damaging	Het
Zfp407	T	C	18: 84,559,464	I1175V	probably benign	Het
Zfp646	T	A	7: 127,881,761	C1037S	possibly damaging	Het
Zfp786	A	T	6: 47,821,268	C245*	probably null	Het
Zfp827	T	C	8: 79,061,183	V326A	probably benign	Het

Other mutations in Tln1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Tln1	APN	4	43542719	missense	probably benign	0.22
IGL00987:Tln1	APN	4	43551297	unclassified	probably benign
IGL01345:Tln1	APN	4	43536281	missense	probably damaging	1.00
IGL01456:Tln1	APN	4	43543432	unclassified	probably benign
IGL01715:Tln1	APN	4	43555890	missense	probably damaging	1.00
IGL01750:Tln1	APN	4	43545435	missense	probably damaging	1.00
IGL01933:Tln1	APN	4	43539508	missense	probably benign
IGL01933:Tln1	APN	4	43555894	missense	possibly damaging	0.52
IGL02119:Tln1	APN	4	43546760	missense	probably damaging	0.99
IGL02148:Tln1	APN	4	43555388	missense	probably damaging	1.00
IGL02153:Tln1	APN	4	43546857	missense	possibly damaging	0.76
IGL02522:Tln1	APN	4	43540612	missense	probably benign	0.07
IGL02691:Tln1	APN	4	43539544	missense	probably benign	0.42
IGL02882:Tln1	APN	4	43539522	missense	probably benign	0.45
IGL02892:Tln1	APN	4	43555679	missense	probably damaging	1.00
IGL03061:Tln1	APN	4	43545694	missense	probably damaging	1.00
IGL03102:Tln1	APN	4	43532861	missense	possibly damaging	0.89
IGL03183:Tln1	APN	4	43539084	splice site	probably benign
H8786:Tln1	UTSW	4	43544589	missense	probably damaging	0.97
PIT4576001:Tln1	UTSW	4	43539998	missense	probably damaging	1.00
PIT4696001:Tln1	UTSW	4	43542701	critical splice donor site	probably null
R0206:Tln1	UTSW	4	43549151	missense	probably damaging	1.00
R0208:Tln1	UTSW	4	43549151	missense	probably damaging	1.00
R0454:Tln1	UTSW	4	43553504	missense	probably benign
R0539:Tln1	UTSW	4	43543434	critical splice donor site	probably null
R0548:Tln1	UTSW	4	43542709	missense	possibly damaging	0.79
R0561:Tln1	UTSW	4	43550304	missense	possibly damaging	0.94
R0606:Tln1	UTSW	4	43547756	missense	probably benign	0.34
R0607:Tln1	UTSW	4	43553071	missense	probably damaging	1.00
R0609:Tln1	UTSW	4	43544645	missense	possibly damaging	0.63
R0847:Tln1	UTSW	4	43555333	missense	probably damaging	1.00
R0993:Tln1	UTSW	4	43549825	missense	probably benign	0.22
R1255:Tln1	UTSW	4	43538044	missense	probably damaging	1.00
R1292:Tln1	UTSW	4	43534578	critical splice donor site	probably null
R1752:Tln1	UTSW	4	43536311	missense	probably damaging	1.00
R2169:Tln1	UTSW	4	43548005	missense	probably damaging	1.00
R2172:Tln1	UTSW	4	43545721	missense	probably benign
R2202:Tln1	UTSW	4	43553083	splice site	probably null
R2680:Tln1	UTSW	4	43539668	missense	probably damaging	1.00
R3012:Tln1	UTSW	4	43542525	missense	probably benign
R3714:Tln1	UTSW	4	43540597	missense	probably damaging	1.00
R3735:Tln1	UTSW	4	43549370	missense	probably damaging	0.97
R3794:Tln1	UTSW	4	43536295	missense	probably damaging	1.00
R3825:Tln1	UTSW	4	43536413	splice site	probably benign
R3983:Tln1	UTSW	4	43553030	missense	probably damaging	1.00
R4061:Tln1	UTSW	4	43549177	missense	probably damaging	1.00
R4249:Tln1	UTSW	4	43536104	missense	probably damaging	1.00
R4287:Tln1	UTSW	4	43543509	missense	probably benign	0.01
R4471:Tln1	UTSW	4	43551018	missense	probably benign	0.03
R4562:Tln1	UTSW	4	43533598	missense	probably damaging	1.00
R4654:Tln1	UTSW	4	43535954	missense	probably null	1.00
R4737:Tln1	UTSW	4	43540588	missense	probably benign	0.00
R5225:Tln1	UTSW	4	43539406	missense	probably benign	0.06
R5288:Tln1	UTSW	4	43540661	missense	probably benign	0.06
R5421:Tln1	UTSW	4	43533609	missense	possibly damaging	0.80
R5445:Tln1	UTSW	4	43543905	missense	probably benign	0.26
R5660:Tln1	UTSW	4	43547732	missense	probably damaging	1.00
R5772:Tln1	UTSW	4	43545191	missense	probably benign	0.13
R6012:Tln1	UTSW	4	43539508	missense	probably benign
R6038:Tln1	UTSW	4	43555052	missense	probably damaging	0.99
R6038:Tln1	UTSW	4	43555052	missense	probably damaging	0.99
R6039:Tln1	UTSW	4	43555052	missense	probably damaging	0.99
R6039:Tln1	UTSW	4	43555052	missense	probably damaging	0.99
R6052:Tln1	UTSW	4	43555052	missense	probably damaging	0.99
R6145:Tln1	UTSW	4	43538030	missense	possibly damaging	0.64
R6157:Tln1	UTSW	4	43534744	missense	probably benign	0.06
R6242:Tln1	UTSW	4	43533145	missense	probably damaging	1.00
R6454:Tln1	UTSW	4	43533866	missense	probably damaging	0.99
R6467:Tln1	UTSW	4	43543165	missense	probably benign	0.42
R6548:Tln1	UTSW	4	43547525	missense	probably damaging	0.98
R6576:Tln1	UTSW	4	43555419	splice site	probably null
R6722:Tln1	UTSW	4	43547618	missense	probably damaging	1.00
R6968:Tln1	UTSW	4	43550217	missense	probably benign	0.02
R7000:Tln1	UTSW	4	43556302	missense	probably damaging	0.96
R7137:Tln1	UTSW	4	43540616	missense	probably damaging	1.00
R7242:Tln1	UTSW	4	43542602	missense	probably benign	0.01
R7294:Tln1	UTSW	4	43534399	missense	probably benign	0.02
R7312:Tln1	UTSW	4	43545922	missense	probably damaging	1.00
R7547:Tln1	UTSW	4	43545206	missense	possibly damaging	0.80
R7836:Tln1	UTSW	4	43554309	missense	probably benign	0.01
R7874:Tln1	UTSW	4	43538041	missense	probably damaging	1.00
R7874:Tln1	UTSW	4	43555606	missense	probably damaging	1.00
R8030:Tln1	UTSW	4	43535737	critical splice donor site	probably null
R8105:Tln1	UTSW	4	43538231	missense	probably benign	0.32
R8212:Tln1	UTSW	4	43555918	missense	probably damaging	1.00
R8416:Tln1	UTSW	4	43540116	missense	probably benign	0.01
R8419:Tln1	UTSW	4	43536397	missense	probably damaging	1.00
R8680:Tln1	UTSW	4	43553041	missense	possibly damaging	0.52
R8708:Tln1	UTSW	4	43534769	splice site	probably benign
R8725:Tln1	UTSW	4	43555911	missense	possibly damaging	0.94
R8727:Tln1	UTSW	4	43555911	missense	possibly damaging	0.94
R8830:Tln1	UTSW	4	43556383	missense	probably benign
R8865:Tln1	UTSW	4	43538281	missense	possibly damaging	0.93
R9049:Tln1	UTSW	4	43549786	nonsense	probably null
R9050:Tln1	UTSW	4	43549786	nonsense	probably null
R9145:Tln1	UTSW	4	43536024	missense	probably damaging	1.00
R9210:Tln1	UTSW	4	43536119	missense	probably damaging	1.00
R9337:Tln1	UTSW	4	43532927	missense	probably damaging	1.00
R9346:Tln1	UTSW	4	43546895	missense	probably damaging	0.97
R9358:Tln1	UTSW	4	43532084	missense	possibly damaging	0.68
R9487:Tln1	UTSW	4	43542893	missense	probably damaging	1.00
R9631:Tln1	UTSW	4	43545694	missense	probably damaging	1.00
RF021:Tln1	UTSW	4	43555890	missense	probably damaging	1.00
X0052:Tln1	UTSW	4	43533125	critical splice donor site	probably null
X0063:Tln1	UTSW	4	43548015	nonsense	probably null
Z1176:Tln1	UTSW	4	43543211	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- TTAGACTGACCAATGAGCCCAG -3'
(R):5'- CCAAGAACAGCTAGTCGAGG -3'

Sequencing Primer
(F):5'- CCAGAGGGACAGAGCTAGAAAG -3'
(R):5'- ACTGGTGGCCAAAGCTGTG -3'

Posted On

2016-04-15