Mutagenetix > Incidental Mutation

Incidental Mutation 'R4936:Bsn'

380388

Institutional Source

Beutler Lab

Gene Symbol

Bsn

Ensembl Gene

ENSMUSG00000032589

Gene Name

bassoon

Synonyms

presynaptic cytomatrix protein

MMRRC Submission

042536-MU

Accession Numbers

Genbank: NM_007567; MGI: 1277955

Essential gene?

Possibly non essential (E-score: 0.270) question?

Stock #

R4936 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108096022-108190384 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 108111761 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 2264 (Y2264C)

Ref Sequence

ENSEMBL: ENSMUSP00000035208 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035208]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000035208
AA Change: Y2264C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: Y2264C

Domain	Start	End	E-Value	Type
low complexity region	4	40	N/A	INTRINSIC
low complexity region	42	77	N/A	INTRINSIC
Pfam:zf-piccolo	165	223	6.1e-30	PFAM
low complexity region	394	409	N/A	INTRINSIC
low complexity region	445	454	N/A	INTRINSIC
Pfam:zf-piccolo	462	520	5.2e-31	PFAM
low complexity region	527	540	N/A	INTRINSIC
low complexity region	627	643	N/A	INTRINSIC
low complexity region	664	681	N/A	INTRINSIC
low complexity region	694	708	N/A	INTRINSIC
low complexity region	788	803	N/A	INTRINSIC
low complexity region	994	1021	N/A	INTRINSIC
coiled coil region	1047	1101	N/A	INTRINSIC
low complexity region	1131	1145	N/A	INTRINSIC
low complexity region	1173	1190	N/A	INTRINSIC
low complexity region	1209	1220	N/A	INTRINSIC
low complexity region	1333	1343	N/A	INTRINSIC
low complexity region	1443	1455	N/A	INTRINSIC
low complexity region	1481	1498	N/A	INTRINSIC
low complexity region	1790	1800	N/A	INTRINSIC
low complexity region	2117	2126	N/A	INTRINSIC
low complexity region	2287	2303	N/A	INTRINSIC
low complexity region	2326	2356	N/A	INTRINSIC
SCOP:d1eq1a_	2362	2477	2e-7	SMART
low complexity region	2607	2614	N/A	INTRINSIC
low complexity region	2635	2651	N/A	INTRINSIC
low complexity region	2655	2672	N/A	INTRINSIC
coiled coil region	2949	2990	N/A	INTRINSIC
low complexity region	3057	3071	N/A	INTRINSIC
low complexity region	3089	3114	N/A	INTRINSIC
low complexity region	3446	3461	N/A	INTRINSIC
low complexity region	3520	3534	N/A	INTRINSIC
low complexity region	3653	3666	N/A	INTRINSIC
low complexity region	3750	3820	N/A	INTRINSIC
low complexity region	3831	3852	N/A	INTRINSIC
low complexity region	3856	3901	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124763

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.0%
20x: 87.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300002M23Rik	T	A	17: 35,568,315	F183L	possibly damaging	Het
4930590J08Rik	T	A	6: 91,944,264	M775K	probably damaging	Het
Actn1	T	G	12: 80,172,998	I700L	probably benign	Het
Adam5	T	C	8: 24,786,271	Y460C	probably damaging	Het
Akna	C	T	4: 63,395,265	G207E	probably damaging	Het
Ank2	T	A	3: 126,955,039	H527L	possibly damaging	Het
Anks1	C	A	17: 27,988,805	N383K	probably damaging	Het
Apba3	C	T	10: 81,269,370		probably null	Het
Atp9b	C	A	18: 80,736,093	V1121F	possibly damaging	Het
Bst1	A	G	5: 43,840,457	D266G	probably damaging	Het
Cep55	A	G	19: 38,071,754		probably null	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Ckb	T	C	12: 111,671,230	K156E	probably benign	Het
Cln3	T	A	7: 126,575,221	H315L	probably damaging	Het
Cnot6l	A	G	5: 96,079,937	F479S	probably damaging	Het
Col1a1	A	G	11: 94,947,132	D826G	unknown	Het
Cyp27a1	T	C	1: 74,735,405	V194A	probably benign	Het
Dis3l2	C	T	1: 87,044,168	P643S	probably benign	Het
Dpf3	T	C	12: 83,331,966	D108G	probably damaging	Het
Eif2b4	C	T	5: 31,192,897	G27D	probably benign	Het
Eif4a1	T	G	11: 69,672,425		probably benign	Het
Espl1	A	T	15: 102,304,937	D566V	probably damaging	Het
Ext2	T	A	2: 93,813,679	R86*	probably null	Het
Fasn	A	T	11: 120,816,085	F914I	probably damaging	Het
Fbf1	A	G	11: 116,152,552	L477P	probably benign	Het
Fsd1	A	T	17: 55,996,452	K441N	possibly damaging	Het
Fsip2	T	A	2: 82,985,040	S3706T	probably benign	Het
Gabra5	A	T	7: 57,408,799	N400K	probably benign	Het
Gimap8	G	T	6: 48,656,134	G296W	probably damaging	Het
Gli2	A	G	1: 118,836,140	V1427A	probably benign	Het
Gm7334	A	T	17: 50,698,827	Y47F	probably damaging	Het
Gm8674	T	G	13: 49,900,755		noncoding transcript	Het
Gmeb2	G	T	2: 181,254,246	T377K	probably benign	Het
Gp9	T	A	6: 87,779,247	D81E	probably benign	Het
Il5ra	T	A	6: 106,738,162	I212F	possibly damaging	Het
Klhl18	G	T	9: 110,428,961	N470K	possibly damaging	Het
Lfng	G	T	5: 140,612,395		probably null	Het
Lpo	A	G	11: 87,810,340	I430T	probably benign	Het
Lrrc31	C	T	3: 30,689,268	D183N	probably damaging	Het
Meis2	T	C	2: 115,864,412	T410A	probably benign	Het
Myo6	A	G	9: 80,307,681	D1232G	probably damaging	Het
Ncapd2	C	T	6: 125,169,840	R1261H	probably benign	Het
Nfkb1	C	T	3: 135,613,982	V251M	probably damaging	Het
Nmbr	C	A	10: 14,766,986	H96Q	probably damaging	Het
Nop14	C	T	5: 34,652,393	R256H	probably damaging	Het
Nqo2	T	A	13: 33,981,518	Y133N	probably damaging	Het
Olfr1153	A	G	2: 87,896,813	I213V	probably benign	Het
Olfr1366	T	C	13: 21,537,187	I273V	probably benign	Het
Pbld2	C	A	10: 63,052,238	S168R	probably damaging	Het
Pcdhb7	G	T	18: 37,342,149	G113*	probably null	Het
Pcdhb7	G	T	18: 37,342,150	G113V	probably damaging	Het
Pdgfra	A	T	5: 75,195,026	T1066S	probably damaging	Het
Prdm8	A	T	5: 98,185,022		probably null	Het
Prdm8	G	T	5: 98,185,023		probably null	Het
Prkg1	T	C	19: 30,586,375	Y479C	probably benign	Het
Pudp	T	C	18: 50,568,468	T65A	probably benign	Het
Rbbp6	C	T	7: 122,999,703		probably benign	Het
Rcc1	C	G	4: 132,335,735	V187L	probably damaging	Het
Rims2	T	A	15: 39,437,728	M285K	probably damaging	Het
Rtkn2	T	C	10: 68,041,915	*602Q	probably null	Het
Rxfp3	T	G	15: 11,036,780	S169R	probably damaging	Het
Sardh	T	C	2: 27,228,241		probably null	Het
Slc24a2	A	T	4: 87,227,347	F157I	probably damaging	Het
Slc25a20	T	C	9: 108,681,992	Y186H	probably damaging	Het
Slc25a24	A	G	3: 109,163,548	R408G	probably damaging	Het
Slc44a5	T	G	3: 154,253,716	I348S	probably damaging	Het
Slc8a2	A	T	7: 16,134,175	K111*	probably null	Het
Smc5	A	G	19: 23,234,003	V589A	probably damaging	Het
Thbd	A	T	2: 148,407,735	I71N	probably damaging	Het
Thsd7b	T	C	1: 129,678,145	M541T	probably benign	Het
Tie1	T	A	4: 118,484,771		silent	Het
Tln1	A	G	4: 43,547,522	F813S	possibly damaging	Het
Tnrc18	A	T	5: 142,765,977	L1191*	probably null	Het
Tubb2a	A	C	13: 34,075,257	Y183*	probably null	Het
Ubr4	T	A	4: 139,396,566	V343E	probably damaging	Het
Vmn2r93	A	T	17: 18,304,065	D107V	possibly damaging	Het
Vwa5a	T	G	9: 38,736,198	S624R	probably benign	Het
Wwox	G	A	8: 114,706,358	V255I	probably benign	Het
Wwp1	T	C	4: 19,638,804	K546E	probably damaging	Het
Xirp2	T	A	2: 67,509,819	F801L	possibly damaging	Het
Zfp407	T	C	18: 84,559,464	I1175V	probably benign	Het
Zfp646	T	A	7: 127,881,761	C1037S	possibly damaging	Het
Zfp786	A	T	6: 47,821,268	C245*	probably null	Het
Zfp827	T	C	8: 79,061,183	V326A	probably benign	Het

Other mutations in Bsn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Bsn	APN	9	108115110	missense	probably benign	0.01
IGL00330:Bsn	APN	9	108115340	missense	probably damaging	1.00
IGL00863:Bsn	APN	9	108115322	missense	probably damaging	1.00
IGL01123:Bsn	APN	9	108115986	missense	probably damaging	1.00
IGL01330:Bsn	APN	9	108110913	unclassified	probably benign
IGL01336:Bsn	APN	9	108111785	missense	probably damaging	0.99
IGL01399:Bsn	APN	9	108107187	missense	unknown
IGL01683:Bsn	APN	9	108114896	missense	possibly damaging	0.71
IGL02022:Bsn	APN	9	108110418	unclassified	probably benign
IGL02396:Bsn	APN	9	108116046	missense	possibly damaging	0.90
IGL02538:Bsn	APN	9	108105236	missense	unknown
IGL02565:Bsn	APN	9	108113288	missense	probably damaging	0.99
IGL02661:Bsn	APN	9	108106936	nonsense	probably null
IGL02739:Bsn	APN	9	108112546	missense	probably benign	0.14
IGL02951:Bsn	APN	9	108115613	missense	probably damaging	1.00
IGL02987:Bsn	APN	9	108126304	missense	probably benign	0.03
IGL03033:Bsn	APN	9	108115993	missense	probably damaging	1.00
IGL03069:Bsn	APN	9	108114263	missense	probably damaging	1.00
IGL03076:Bsn	APN	9	108105382	missense	unknown
R0068:Bsn	UTSW	9	108112137	missense	probably damaging	1.00
R0068:Bsn	UTSW	9	108112137	missense	probably damaging	1.00
R0167:Bsn	UTSW	9	108125986	missense	probably benign	0.01
R0234:Bsn	UTSW	9	108116396	missense	possibly damaging	0.50
R0234:Bsn	UTSW	9	108116396	missense	possibly damaging	0.50
R0359:Bsn	UTSW	9	108111846	missense	possibly damaging	0.81
R0514:Bsn	UTSW	9	108125782	missense	probably benign	0.07
R0593:Bsn	UTSW	9	108110306	missense	unknown
R0617:Bsn	UTSW	9	108107240	missense	unknown
R0636:Bsn	UTSW	9	108107834	missense	unknown
R0652:Bsn	UTSW	9	108105742	missense	unknown
R0718:Bsn	UTSW	9	108111360	unclassified	probably benign
R0730:Bsn	UTSW	9	108106812	missense	unknown
R0905:Bsn	UTSW	9	108105635	missense	unknown
R0963:Bsn	UTSW	9	108111807	missense	possibly damaging	0.81
R0992:Bsn	UTSW	9	108114354	nonsense	probably null
R1101:Bsn	UTSW	9	108116411	missense	probably damaging	1.00
R1393:Bsn	UTSW	9	108110517	unclassified	probably benign
R1490:Bsn	UTSW	9	108113994	missense	probably benign	0.03
R1566:Bsn	UTSW	9	108125985	missense	probably benign	0.35
R1582:Bsn	UTSW	9	108105092	missense	unknown
R1738:Bsn	UTSW	9	108106934	missense	unknown
R1867:Bsn	UTSW	9	108106719	missense	unknown
R1918:Bsn	UTSW	9	108107573	missense	unknown
R1933:Bsn	UTSW	9	108116444	missense	possibly damaging	0.91
R1946:Bsn	UTSW	9	108114651	missense	probably damaging	0.99
R1978:Bsn	UTSW	9	108114549	missense	probably benign	0.35
R2068:Bsn	UTSW	9	108110684	unclassified	probably benign
R2068:Bsn	UTSW	9	108126550	missense	possibly damaging	0.95
R2113:Bsn	UTSW	9	108114886	missense	probably benign	0.14
R2136:Bsn	UTSW	9	108113231	missense	probably damaging	1.00
R2172:Bsn	UTSW	9	108109992	intron	probably benign
R2266:Bsn	UTSW	9	108115124	missense	probably damaging	1.00
R2293:Bsn	UTSW	9	108113067	missense	possibly damaging	0.47
R2294:Bsn	UTSW	9	108113067	missense	possibly damaging	0.47
R2368:Bsn	UTSW	9	108111030	nonsense	probably null
R2442:Bsn	UTSW	9	108106920	missense	unknown
R2507:Bsn	UTSW	9	108116114	missense	probably damaging	1.00
R2880:Bsn	UTSW	9	108113067	missense	possibly damaging	0.47
R2881:Bsn	UTSW	9	108113067	missense	possibly damaging	0.47
R2922:Bsn	UTSW	9	108108186	missense	unknown
R2922:Bsn	UTSW	9	108115469	missense	probably damaging	1.00
R3618:Bsn	UTSW	9	108117561	critical splice acceptor site	probably null
R3742:Bsn	UTSW	9	108105739	missense	unknown
R3825:Bsn	UTSW	9	108106856	missense	unknown
R3982:Bsn	UTSW	9	108107166	missense	unknown
R4094:Bsn	UTSW	9	108113870	missense	probably damaging	1.00
R4158:Bsn	UTSW	9	108112946	missense	possibly damaging	0.95
R4225:Bsn	UTSW	9	108106733	missense	unknown
R4261:Bsn	UTSW	9	108110684	unclassified	probably benign
R4482:Bsn	UTSW	9	108114664	missense	probably damaging	1.00
R4515:Bsn	UTSW	9	108104078	splice site	probably null
R4585:Bsn	UTSW	9	108110463	unclassified	probably benign
R4628:Bsn	UTSW	9	108113235	missense	probably damaging	1.00
R4636:Bsn	UTSW	9	108115424	missense	probably damaging	1.00
R4679:Bsn	UTSW	9	108110130	missense	unknown
R4723:Bsn	UTSW	9	108112655	missense	probably benign	0.03
R4843:Bsn	UTSW	9	108107189	missense	unknown
R4885:Bsn	UTSW	9	108107527	nonsense	probably null
R4942:Bsn	UTSW	9	108106479	missense	unknown
R4972:Bsn	UTSW	9	108115178	missense	probably damaging	1.00
R4992:Bsn	UTSW	9	108115548	missense	probably damaging	1.00
R5067:Bsn	UTSW	9	108111953	missense	probably damaging	1.00
R5206:Bsn	UTSW	9	108105373	missense	unknown
R5286:Bsn	UTSW	9	108110924	unclassified	probably benign
R5492:Bsn	UTSW	9	108112515	missense	probably damaging	0.98
R5553:Bsn	UTSW	9	108110421	unclassified	probably benign
R5561:Bsn	UTSW	9	108105511	missense	unknown
R5597:Bsn	UTSW	9	108114932	missense	probably benign	0.06
R5646:Bsn	UTSW	9	108110432	unclassified	probably benign
R5796:Bsn	UTSW	9	108126024	missense	probably damaging	1.00
R5801:Bsn	UTSW	9	108113009	missense	possibly damaging	0.81
R5802:Bsn	UTSW	9	108113009	missense	possibly damaging	0.81
R5850:Bsn	UTSW	9	108114950	missense	probably damaging	0.99
R5938:Bsn	UTSW	9	108113009	missense	possibly damaging	0.81
R6221:Bsn	UTSW	9	108105566	missense	unknown
R6243:Bsn	UTSW	9	108107561	missense	unknown
R6254:Bsn	UTSW	9	108111866	missense	probably damaging	0.96
R6263:Bsn	UTSW	9	108113254	missense	probably damaging	1.00
R6345:Bsn	UTSW	9	108107355	missense	unknown
R6368:Bsn	UTSW	9	108111314	unclassified	probably benign
R6574:Bsn	UTSW	9	108113954	missense	possibly damaging	0.95
R6793:Bsn	UTSW	9	108114615	nonsense	probably null
R6802:Bsn	UTSW	9	108110624	unclassified	probably benign
R6943:Bsn	UTSW	9	108107817	missense	unknown
R6999:Bsn	UTSW	9	108113433	missense	probably benign	0.00
R7149:Bsn	UTSW	9	108116321	nonsense	probably null
R7199:Bsn	UTSW	9	108115334	missense	probably damaging	1.00
R7322:Bsn	UTSW	9	108126421	nonsense	probably null
R7349:Bsn	UTSW	9	108110783	missense	unknown
R7372:Bsn	UTSW	9	108110519	missense	unknown
R7373:Bsn	UTSW	9	108113484	missense	probably damaging	1.00
R7413:Bsn	UTSW	9	108139491	missense	possibly damaging	0.61
R7473:Bsn	UTSW	9	108112250	missense	probably damaging	1.00
R7482:Bsn	UTSW	9	108113529	missense	probably damaging	0.98
R7530:Bsn	UTSW	9	108111956	missense	probably damaging	1.00
R7549:Bsn	UTSW	9	108114815	missense	probably benign	0.05
R7570:Bsn	UTSW	9	108113543	missense	probably damaging	1.00
R7635:Bsn	UTSW	9	108110990	missense	unknown
R7696:Bsn	UTSW	9	108114501	missense	probably damaging	1.00
R7757:Bsn	UTSW	9	108114740	missense	possibly damaging	0.90
R7868:Bsn	UTSW	9	108114899	missense	possibly damaging	0.95
R7897:Bsn	UTSW	9	108111866	missense	probably damaging	0.98
R7960:Bsn	UTSW	9	108115548	missense	probably damaging	1.00
R8022:Bsn	UTSW	9	108114404	missense	probably benign	0.01
R8056:Bsn	UTSW	9	108105307	missense
R8158:Bsn	UTSW	9	108110033	missense	unknown
R8161:Bsn	UTSW	9	108139530	missense	probably benign	0.20
R8225:Bsn	UTSW	9	108107106	missense
R8282:Bsn	UTSW	9	108107691	missense	possibly damaging	0.73
R8296:Bsn	UTSW	9	108117379	missense	probably benign	0.00
R8415:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8417:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8426:Bsn	UTSW	9	108126573	missense	probably damaging	1.00
R8437:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8438:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8439:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8440:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8441:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8442:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8513:Bsn	UTSW	9	108114510	missense	possibly damaging	0.65
R8529:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8535:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8546:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8548:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8549:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8682:Bsn	UTSW	9	108106169	missense
R8773:Bsn	UTSW	9	108110505	missense	unknown
R8883:Bsn	UTSW	9	108113028	missense	probably damaging	0.98
R8906:Bsn	UTSW	9	108107553	missense	unknown
R9018:Bsn	UTSW	9	108117289	missense	probably benign	0.06
R9070:Bsn	UTSW	9	108110096	missense
R9094:Bsn	UTSW	9	108110853	missense	unknown
R9098:Bsn	UTSW	9	108112974	missense	possibly damaging	0.65
R9128:Bsn	UTSW	9	108116150	missense	probably benign	0.21
R9162:Bsn	UTSW	9	108110684	missense	unknown
R9224:Bsn	UTSW	9	108105487	missense
R9230:Bsn	UTSW	9	108112260	missense	probably damaging	1.00
R9233:Bsn	UTSW	9	108117090	missense	probably benign	0.28
R9245:Bsn	UTSW	9	108116093	missense	probably damaging	1.00
R9275:Bsn	UTSW	9	108111620	missense	probably damaging	1.00
R9307:Bsn	UTSW	9	108115794	missense	probably benign	0.01
R9343:Bsn	UTSW	9	108115502	missense	probably damaging	1.00
R9377:Bsn	UTSW	9	108113601	missense	probably damaging	1.00
R9377:Bsn	UTSW	9	108116162	missense	probably damaging	1.00
R9378:Bsn	UTSW	9	108107655	missense	possibly damaging	0.85
R9408:Bsn	UTSW	9	108139453	nonsense	probably null
R9455:Bsn	UTSW	9	108111332	missense	unknown
R9563:Bsn	UTSW	9	108107417	missense
R9615:Bsn	UTSW	9	108107231	missense
R9656:Bsn	UTSW	9	108117208	missense	probably benign	0.09
R9698:Bsn	UTSW	9	108115971	missense	probably damaging	1.00
X0028:Bsn	UTSW	9	108113504	missense	probably damaging	1.00
X0066:Bsn	UTSW	9	108139210	missense	probably damaging	1.00
Z1177:Bsn	UTSW	9	108105499	missense
Z1177:Bsn	UTSW	9	108139195	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCCTTGATGACAGCAGGGG -3'
(R):5'- CTGGAAACCTTGCTCAGTATGG -3'

Sequencing Primer
(F):5'- GCAGTTGTGGAAAAGGGTTCTTCAC -3'
(R):5'- CCGATGGCATGATCTATTCGAC -3'

Posted On

2016-04-15