Incidental Mutation 'R4936:Rims2'
ID 380408
Institutional Source Beutler Lab
Gene Symbol Rims2
Ensembl Gene ENSMUSG00000037386
Gene Name regulating synaptic membrane exocytosis 2
Synonyms 2810036I15Rik, Syt3-rs, RIM2
MMRRC Submission 042536-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.518) question?
Stock # R4936 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 39198261-39684372 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 39437728 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 285 (M285K)
Ref Sequence ENSEMBL: ENSMUSP00000154645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042917] [ENSMUST00000082054] [ENSMUST00000227243] [ENSMUST00000228839]
AlphaFold Q9EQZ7
Predicted Effect probably damaging
Transcript: ENSMUST00000042917
AA Change: M477K

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048719
Gene: ENSMUSG00000037386
AA Change: M477K

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:FYVE_2 30 154 9.5e-18 PFAM
low complexity region 315 335 N/A INTRINSIC
low complexity region 492 498 N/A INTRINSIC
low complexity region 511 521 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
PDZ 646 725 8.27e-16 SMART
low complexity region 740 748 N/A INTRINSIC
C2 790 897 4.08e-21 SMART
low complexity region 905 919 N/A INTRINSIC
low complexity region 1085 1101 N/A INTRINSIC
low complexity region 1116 1130 N/A INTRINSIC
low complexity region 1208 1238 N/A INTRINSIC
C2 1432 1535 3.78e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000082054
AA Change: M517K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080711
Gene: ENSMUSG00000037386
AA Change: M517K

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:FYVE_2 76 194 2.2e-11 PFAM
low complexity region 355 375 N/A INTRINSIC
low complexity region 532 538 N/A INTRINSIC
low complexity region 551 561 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
PDZ 686 765 8.27e-16 SMART
low complexity region 780 788 N/A INTRINSIC
C2 830 937 4.08e-21 SMART
low complexity region 945 959 N/A INTRINSIC
low complexity region 1075 1086 N/A INTRINSIC
low complexity region 1166 1196 N/A INTRINSIC
C2 1390 1493 3.78e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226243
Predicted Effect probably damaging
Transcript: ENSMUST00000227243
AA Change: M477K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect unknown
Transcript: ENSMUST00000227381
AA Change: M244K
Predicted Effect probably damaging
Transcript: ENSMUST00000228839
AA Change: M285K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228867
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a presynaptic protein that interacts with RAB3, a protein important for normal neurotransmitter release. The encoded protein can also bind several other synaptic proteins, including UNC-13 homolog B, ELKS/Rab6-interacting/CAST family member 1, and synaptotagmin 1. This protein is involved in synaptic membrane exocytosis. Polymorphisms in this gene have been associated with degenerative lumbar scoliosis. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele show reduced body size, aberrant insulin granule exocytosis, and impaired secretion of hormones associated with glucose homeostasis. Mice homozygous for another knock-out allele show a slightly reduced body size, abnormal maternal behavior and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,315 F183L possibly damaging Het
4930590J08Rik T A 6: 91,944,264 M775K probably damaging Het
Actn1 T G 12: 80,172,998 I700L probably benign Het
Adam5 T C 8: 24,786,271 Y460C probably damaging Het
Akna C T 4: 63,395,265 G207E probably damaging Het
Ank2 T A 3: 126,955,039 H527L possibly damaging Het
Anks1 C A 17: 27,988,805 N383K probably damaging Het
Apba3 C T 10: 81,269,370 probably null Het
Atp9b C A 18: 80,736,093 V1121F possibly damaging Het
Bsn T C 9: 108,111,761 Y2264C probably damaging Het
Bst1 A G 5: 43,840,457 D266G probably damaging Het
Cep55 A G 19: 38,071,754 probably null Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Ckb T C 12: 111,671,230 K156E probably benign Het
Cln3 T A 7: 126,575,221 H315L probably damaging Het
Cnot6l A G 5: 96,079,937 F479S probably damaging Het
Col1a1 A G 11: 94,947,132 D826G unknown Het
Cyp27a1 T C 1: 74,735,405 V194A probably benign Het
Dis3l2 C T 1: 87,044,168 P643S probably benign Het
Dpf3 T C 12: 83,331,966 D108G probably damaging Het
Eif2b4 C T 5: 31,192,897 G27D probably benign Het
Eif4a1 T G 11: 69,672,425 probably benign Het
Espl1 A T 15: 102,304,937 D566V probably damaging Het
Ext2 T A 2: 93,813,679 R86* probably null Het
Fasn A T 11: 120,816,085 F914I probably damaging Het
Fbf1 A G 11: 116,152,552 L477P probably benign Het
Fsd1 A T 17: 55,996,452 K441N possibly damaging Het
Fsip2 T A 2: 82,985,040 S3706T probably benign Het
Gabra5 A T 7: 57,408,799 N400K probably benign Het
Gimap8 G T 6: 48,656,134 G296W probably damaging Het
Gli2 A G 1: 118,836,140 V1427A probably benign Het
Gm7334 A T 17: 50,698,827 Y47F probably damaging Het
Gm8674 T G 13: 49,900,755 noncoding transcript Het
Gmeb2 G T 2: 181,254,246 T377K probably benign Het
Gp9 T A 6: 87,779,247 D81E probably benign Het
Il5ra T A 6: 106,738,162 I212F possibly damaging Het
Klhl18 G T 9: 110,428,961 N470K possibly damaging Het
Lfng G T 5: 140,612,395 probably null Het
Lpo A G 11: 87,810,340 I430T probably benign Het
Lrrc31 C T 3: 30,689,268 D183N probably damaging Het
Meis2 T C 2: 115,864,412 T410A probably benign Het
Myo6 A G 9: 80,307,681 D1232G probably damaging Het
Ncapd2 C T 6: 125,169,840 R1261H probably benign Het
Nfkb1 C T 3: 135,613,982 V251M probably damaging Het
Nmbr C A 10: 14,766,986 H96Q probably damaging Het
Nop14 C T 5: 34,652,393 R256H probably damaging Het
Nqo2 T A 13: 33,981,518 Y133N probably damaging Het
Olfr1153 A G 2: 87,896,813 I213V probably benign Het
Olfr1366 T C 13: 21,537,187 I273V probably benign Het
Pbld2 C A 10: 63,052,238 S168R probably damaging Het
Pcdhb7 G T 18: 37,342,149 G113* probably null Het
Pcdhb7 G T 18: 37,342,150 G113V probably damaging Het
Pdgfra A T 5: 75,195,026 T1066S probably damaging Het
Prdm8 A T 5: 98,185,022 probably null Het
Prdm8 G T 5: 98,185,023 probably null Het
Prkg1 T C 19: 30,586,375 Y479C probably benign Het
Pudp T C 18: 50,568,468 T65A probably benign Het
Rbbp6 C T 7: 122,999,703 probably benign Het
Rcc1 C G 4: 132,335,735 V187L probably damaging Het
Rtkn2 T C 10: 68,041,915 *602Q probably null Het
Rxfp3 T G 15: 11,036,780 S169R probably damaging Het
Sardh T C 2: 27,228,241 probably null Het
Slc24a2 A T 4: 87,227,347 F157I probably damaging Het
Slc25a20 T C 9: 108,681,992 Y186H probably damaging Het
Slc25a24 A G 3: 109,163,548 R408G probably damaging Het
Slc44a5 T G 3: 154,253,716 I348S probably damaging Het
Slc8a2 A T 7: 16,134,175 K111* probably null Het
Smc5 A G 19: 23,234,003 V589A probably damaging Het
Thbd A T 2: 148,407,735 I71N probably damaging Het
Thsd7b T C 1: 129,678,145 M541T probably benign Het
Tie1 T A 4: 118,484,771 silent Het
Tln1 A G 4: 43,547,522 F813S possibly damaging Het
Tnrc18 A T 5: 142,765,977 L1191* probably null Het
Tubb2a A C 13: 34,075,257 Y183* probably null Het
Ubr4 T A 4: 139,396,566 V343E probably damaging Het
Vmn2r93 A T 17: 18,304,065 D107V possibly damaging Het
Vwa5a T G 9: 38,736,198 S624R probably benign Het
Wwox G A 8: 114,706,358 V255I probably benign Het
Wwp1 T C 4: 19,638,804 K546E probably damaging Het
Xirp2 T A 2: 67,509,819 F801L possibly damaging Het
Zfp407 T C 18: 84,559,464 I1175V probably benign Het
Zfp646 T A 7: 127,881,761 C1037S possibly damaging Het
Zfp786 A T 6: 47,821,268 C245* probably null Het
Zfp827 T C 8: 79,061,183 V326A probably benign Het
Other mutations in Rims2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Rims2 APN 15 39459615 missense probably benign 0.11
IGL00502:Rims2 APN 15 39506984 missense probably damaging 1.00
IGL00556:Rims2 APN 15 39456674 splice site probably null
IGL00811:Rims2 APN 15 39292149 missense probably damaging 1.00
IGL00827:Rims2 APN 15 39472359 missense probably damaging 0.99
IGL01642:Rims2 APN 15 39457796 missense probably damaging 1.00
IGL02951:Rims2 APN 15 39534938 missense probably damaging 1.00
IGL03009:Rims2 APN 15 39566997 missense possibly damaging 0.85
IGL03080:Rims2 APN 15 39535903 missense probably damaging 1.00
IGL03102:Rims2 APN 15 39459593 missense possibly damaging 0.95
IGL03252:Rims2 APN 15 39452352 missense probably benign
IGL03365:Rims2 APN 15 39476541 missense probably damaging 1.00
IGL03393:Rims2 APN 15 39462613 splice site probably null
IGL03409:Rims2 APN 15 39456733 missense probably damaging 1.00
rhyme UTSW 15 39452328 missense probably damaging 1.00
PIT4486001:Rims2 UTSW 15 39476520 missense possibly damaging 0.67
R0009:Rims2 UTSW 15 39534966 missense probably damaging 0.99
R0009:Rims2 UTSW 15 39534966 missense probably damaging 0.99
R0078:Rims2 UTSW 15 39534855 missense probably benign 0.42
R0367:Rims2 UTSW 15 39462615 splice site probably null
R0401:Rims2 UTSW 15 39509632 splice site probably benign
R0531:Rims2 UTSW 15 39567030 missense probably damaging 1.00
R0791:Rims2 UTSW 15 39679625 splice site probably benign
R0838:Rims2 UTSW 15 39681025 missense probably benign 0.02
R1201:Rims2 UTSW 15 39616324 missense possibly damaging 0.91
R1318:Rims2 UTSW 15 39517826 missense probably damaging 0.99
R1457:Rims2 UTSW 15 39511314 missense possibly damaging 0.63
R1619:Rims2 UTSW 15 39506986 missense probably damaging 1.00
R1672:Rims2 UTSW 15 39292189 missense probably benign 0.09
R1743:Rims2 UTSW 15 39679650 missense probably benign 0.10
R1766:Rims2 UTSW 15 39462580 missense probably damaging 0.99
R1779:Rims2 UTSW 15 39681702 missense probably damaging 1.00
R1804:Rims2 UTSW 15 39437043 nonsense probably null
R1985:Rims2 UTSW 15 39345314 missense probably damaging 0.99
R1986:Rims2 UTSW 15 39345314 missense probably damaging 0.99
R2113:Rims2 UTSW 15 39511326 missense probably benign 0.17
R2260:Rims2 UTSW 15 39478566 nonsense probably null
R2510:Rims2 UTSW 15 39585652 missense probably damaging 1.00
R3693:Rims2 UTSW 15 39478575 missense probably benign 0.01
R3937:Rims2 UTSW 15 39437845 missense probably damaging 1.00
R4425:Rims2 UTSW 15 39437924 critical splice donor site probably null
R4453:Rims2 UTSW 15 39292208 missense probably damaging 1.00
R4474:Rims2 UTSW 15 39462560 missense probably damaging 1.00
R4518:Rims2 UTSW 15 39437526 missense probably damaging 1.00
R4526:Rims2 UTSW 15 39437717 missense probably damaging 1.00
R4833:Rims2 UTSW 15 39535914 missense probably damaging 0.98
R4993:Rims2 UTSW 15 39454445 missense possibly damaging 0.90
R5001:Rims2 UTSW 15 39452428 missense probably benign 0.03
R5054:Rims2 UTSW 15 39517869 splice site probably null
R5072:Rims2 UTSW 15 39462590 missense probably benign 0.01
R5171:Rims2 UTSW 15 39437103 missense probably damaging 1.00
R5429:Rims2 UTSW 15 39345355 missense probably damaging 1.00
R5623:Rims2 UTSW 15 39478615 missense probably damaging 1.00
R5624:Rims2 UTSW 15 39345413 missense possibly damaging 0.46
R5685:Rims2 UTSW 15 39437206 missense possibly damaging 0.67
R5784:Rims2 UTSW 15 39535987 splice site probably null
R5790:Rims2 UTSW 15 39681045 missense probably damaging 1.00
R5822:Rims2 UTSW 15 39476490 missense probably damaging 1.00
R5963:Rims2 UTSW 15 39437182 missense probably damaging 1.00
R5988:Rims2 UTSW 15 39292182 missense probably damaging 1.00
R6057:Rims2 UTSW 15 39675020 missense probably damaging 1.00
R6239:Rims2 UTSW 15 39198363 start codon destroyed unknown
R6407:Rims2 UTSW 15 39452328 missense probably damaging 1.00
R6418:Rims2 UTSW 15 39509696 missense probably damaging 1.00
R6495:Rims2 UTSW 15 39517812 missense probably benign 0.01
R6502:Rims2 UTSW 15 39534855 missense probably benign 0.42
R6753:Rims2 UTSW 15 39566973 missense possibly damaging 0.74
R6855:Rims2 UTSW 15 39345515 missense probably benign 0.06
R6948:Rims2 UTSW 15 39511341 missense probably benign
R7058:Rims2 UTSW 15 39585648 missense probably damaging 1.00
R7167:Rims2 UTSW 15 39437077 missense probably benign
R7217:Rims2 UTSW 15 39476489 missense probably damaging 0.99
R7223:Rims2 UTSW 15 39437032 missense probably benign 0.30
R7289:Rims2 UTSW 15 39437718 missense probably benign 0.00
R7459:Rims2 UTSW 15 39517839 missense probably benign
R7663:Rims2 UTSW 15 39507026 missense probably damaging 1.00
R7792:Rims2 UTSW 15 39198528 missense possibly damaging 0.69
R7836:Rims2 UTSW 15 39681079 missense probably damaging 1.00
R8082:Rims2 UTSW 15 39476523 missense probably benign 0.34
R8489:Rims2 UTSW 15 39616450 missense probably damaging 1.00
R8730:Rims2 UTSW 15 39517843 missense probably benign 0.01
R8830:Rims2 UTSW 15 39437362 missense possibly damaging 0.64
R8857:Rims2 UTSW 15 39679648 missense possibly damaging 0.95
R8893:Rims2 UTSW 15 39534954 missense probably benign 0.02
R9010:Rims2 UTSW 15 39452390 nonsense probably null
R9030:Rims2 UTSW 15 39476477 missense probably damaging 1.00
R9287:Rims2 UTSW 15 39679690 missense probably damaging 1.00
R9395:Rims2 UTSW 15 39292269 missense probably damaging 1.00
R9451:Rims2 UTSW 15 39437328 missense probably damaging 1.00
R9506:Rims2 UTSW 15 39472436 missense probably damaging 0.97
X0034:Rims2 UTSW 15 39437534 missense probably benign
Z1177:Rims2 UTSW 15 39437769 missense probably benign 0.24
Z1177:Rims2 UTSW 15 39478690 frame shift probably null
Z1177:Rims2 UTSW 15 39681114 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTAGAGCTGCAATGGAAAACC -3'
(R):5'- GCTCCACATCATCACAGCTTG -3'

Sequencing Primer
(F):5'- GAGGCTCAGGGACAAAGTTCTTATC -3'
(R):5'- CATCACAGCTTGTATACTCAGGTGTG -3'
Posted On 2016-04-15