Mutagenetix > Incidental Mutation

Incidental Mutation 'R4936:Rims2'

380408

Institutional Source

Beutler Lab

Gene Symbol

Rims2

Ensembl Gene

ENSMUSG00000037386

Gene Name

regulating synaptic membrane exocytosis 2

Synonyms

2810036I15Rik, Syt3-rs, RIM2

MMRRC Submission

042536-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.518) question?

Stock #

R4936 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

39198261-39684372 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 39437728 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 285 (M285K)

Ref Sequence

ENSEMBL: ENSMUSP00000154645 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042917] [ENSMUST00000082054] [ENSMUST00000227243] [ENSMUST00000228839]

AlphaFold

Q9EQZ7

Predicted Effect

probably damaging
Transcript: ENSMUST00000042917
AA Change: M477K

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000048719
Gene: ENSMUSG00000037386
AA Change: M477K

Domain	Start	End	E-Value	Type
low complexity region	3	24	N/A	INTRINSIC
Pfam:FYVE_2	30	154	9.5e-18	PFAM
low complexity region	315	335	N/A	INTRINSIC
low complexity region	492	498	N/A	INTRINSIC
low complexity region	511	521	N/A	INTRINSIC
low complexity region	527	540	N/A	INTRINSIC
PDZ	646	725	8.27e-16	SMART
low complexity region	740	748	N/A	INTRINSIC
C2	790	897	4.08e-21	SMART
low complexity region	905	919	N/A	INTRINSIC
low complexity region	1085	1101	N/A	INTRINSIC
low complexity region	1116	1130	N/A	INTRINSIC
low complexity region	1208	1238	N/A	INTRINSIC
C2	1432	1535	3.78e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000082054
AA Change: M517K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000080711
Gene: ENSMUSG00000037386
AA Change: M517K

Domain	Start	End	E-Value	Type
low complexity region	3	24	N/A	INTRINSIC
Pfam:FYVE_2	76	194	2.2e-11	PFAM
low complexity region	355	375	N/A	INTRINSIC
low complexity region	532	538	N/A	INTRINSIC
low complexity region	551	561	N/A	INTRINSIC
low complexity region	567	580	N/A	INTRINSIC
PDZ	686	765	8.27e-16	SMART
low complexity region	780	788	N/A	INTRINSIC
C2	830	937	4.08e-21	SMART
low complexity region	945	959	N/A	INTRINSIC
low complexity region	1075	1086	N/A	INTRINSIC
low complexity region	1166	1196	N/A	INTRINSIC
C2	1390	1493	3.78e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226243

Predicted Effect

probably damaging
Transcript: ENSMUST00000227243
AA Change: M477K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

Predicted Effect

unknown
Transcript: ENSMUST00000227381
AA Change: M244K

Predicted Effect

probably damaging
Transcript: ENSMUST00000228839
AA Change: M285K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228867

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.0%
20x: 87.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a presynaptic protein that interacts with RAB3, a protein important for normal neurotransmitter release. The encoded protein can also bind several other synaptic proteins, including UNC-13 homolog B, ELKS/Rab6-interacting/CAST family member 1, and synaptotagmin 1. This protein is involved in synaptic membrane exocytosis. Polymorphisms in this gene have been associated with degenerative lumbar scoliosis. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele show reduced body size, aberrant insulin granule exocytosis, and impaired secretion of hormones associated with glucose homeostasis. Mice homozygous for another knock-out allele show a slightly reduced body size, abnormal maternal behavior and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300002M23Rik	T	A	17: 35,568,315	F183L	possibly damaging	Het
4930590J08Rik	T	A	6: 91,944,264	M775K	probably damaging	Het
Actn1	T	G	12: 80,172,998	I700L	probably benign	Het
Adam5	T	C	8: 24,786,271	Y460C	probably damaging	Het
Akna	C	T	4: 63,395,265	G207E	probably damaging	Het
Ank2	T	A	3: 126,955,039	H527L	possibly damaging	Het
Anks1	C	A	17: 27,988,805	N383K	probably damaging	Het
Apba3	C	T	10: 81,269,370		probably null	Het
Atp9b	C	A	18: 80,736,093	V1121F	possibly damaging	Het
Bsn	T	C	9: 108,111,761	Y2264C	probably damaging	Het
Bst1	A	G	5: 43,840,457	D266G	probably damaging	Het
Cep55	A	G	19: 38,071,754		probably null	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Ckb	T	C	12: 111,671,230	K156E	probably benign	Het
Cln3	T	A	7: 126,575,221	H315L	probably damaging	Het
Cnot6l	A	G	5: 96,079,937	F479S	probably damaging	Het
Col1a1	A	G	11: 94,947,132	D826G	unknown	Het
Cyp27a1	T	C	1: 74,735,405	V194A	probably benign	Het
Dis3l2	C	T	1: 87,044,168	P643S	probably benign	Het
Dpf3	T	C	12: 83,331,966	D108G	probably damaging	Het
Eif2b4	C	T	5: 31,192,897	G27D	probably benign	Het
Eif4a1	T	G	11: 69,672,425		probably benign	Het
Espl1	A	T	15: 102,304,937	D566V	probably damaging	Het
Ext2	T	A	2: 93,813,679	R86*	probably null	Het
Fasn	A	T	11: 120,816,085	F914I	probably damaging	Het
Fbf1	A	G	11: 116,152,552	L477P	probably benign	Het
Fsd1	A	T	17: 55,996,452	K441N	possibly damaging	Het
Fsip2	T	A	2: 82,985,040	S3706T	probably benign	Het
Gabra5	A	T	7: 57,408,799	N400K	probably benign	Het
Gimap8	G	T	6: 48,656,134	G296W	probably damaging	Het
Gli2	A	G	1: 118,836,140	V1427A	probably benign	Het
Gm7334	A	T	17: 50,698,827	Y47F	probably damaging	Het
Gm8674	T	G	13: 49,900,755		noncoding transcript	Het
Gmeb2	G	T	2: 181,254,246	T377K	probably benign	Het
Gp9	T	A	6: 87,779,247	D81E	probably benign	Het
Il5ra	T	A	6: 106,738,162	I212F	possibly damaging	Het
Klhl18	G	T	9: 110,428,961	N470K	possibly damaging	Het
Lfng	G	T	5: 140,612,395		probably null	Het
Lpo	A	G	11: 87,810,340	I430T	probably benign	Het
Lrrc31	C	T	3: 30,689,268	D183N	probably damaging	Het
Meis2	T	C	2: 115,864,412	T410A	probably benign	Het
Myo6	A	G	9: 80,307,681	D1232G	probably damaging	Het
Ncapd2	C	T	6: 125,169,840	R1261H	probably benign	Het
Nfkb1	C	T	3: 135,613,982	V251M	probably damaging	Het
Nmbr	C	A	10: 14,766,986	H96Q	probably damaging	Het
Nop14	C	T	5: 34,652,393	R256H	probably damaging	Het
Nqo2	T	A	13: 33,981,518	Y133N	probably damaging	Het
Olfr1153	A	G	2: 87,896,813	I213V	probably benign	Het
Olfr1366	T	C	13: 21,537,187	I273V	probably benign	Het
Pbld2	C	A	10: 63,052,238	S168R	probably damaging	Het
Pcdhb7	G	T	18: 37,342,149	G113*	probably null	Het
Pcdhb7	G	T	18: 37,342,150	G113V	probably damaging	Het
Pdgfra	A	T	5: 75,195,026	T1066S	probably damaging	Het
Prdm8	A	T	5: 98,185,022		probably null	Het
Prdm8	G	T	5: 98,185,023		probably null	Het
Prkg1	T	C	19: 30,586,375	Y479C	probably benign	Het
Pudp	T	C	18: 50,568,468	T65A	probably benign	Het
Rbbp6	C	T	7: 122,999,703		probably benign	Het
Rcc1	C	G	4: 132,335,735	V187L	probably damaging	Het
Rtkn2	T	C	10: 68,041,915	*602Q	probably null	Het
Rxfp3	T	G	15: 11,036,780	S169R	probably damaging	Het
Sardh	T	C	2: 27,228,241		probably null	Het
Slc24a2	A	T	4: 87,227,347	F157I	probably damaging	Het
Slc25a20	T	C	9: 108,681,992	Y186H	probably damaging	Het
Slc25a24	A	G	3: 109,163,548	R408G	probably damaging	Het
Slc44a5	T	G	3: 154,253,716	I348S	probably damaging	Het
Slc8a2	A	T	7: 16,134,175	K111*	probably null	Het
Smc5	A	G	19: 23,234,003	V589A	probably damaging	Het
Thbd	A	T	2: 148,407,735	I71N	probably damaging	Het
Thsd7b	T	C	1: 129,678,145	M541T	probably benign	Het
Tie1	T	A	4: 118,484,771		silent	Het
Tln1	A	G	4: 43,547,522	F813S	possibly damaging	Het
Tnrc18	A	T	5: 142,765,977	L1191*	probably null	Het
Tubb2a	A	C	13: 34,075,257	Y183*	probably null	Het
Ubr4	T	A	4: 139,396,566	V343E	probably damaging	Het
Vmn2r93	A	T	17: 18,304,065	D107V	possibly damaging	Het
Vwa5a	T	G	9: 38,736,198	S624R	probably benign	Het
Wwox	G	A	8: 114,706,358	V255I	probably benign	Het
Wwp1	T	C	4: 19,638,804	K546E	probably damaging	Het
Xirp2	T	A	2: 67,509,819	F801L	possibly damaging	Het
Zfp407	T	C	18: 84,559,464	I1175V	probably benign	Het
Zfp646	T	A	7: 127,881,761	C1037S	possibly damaging	Het
Zfp786	A	T	6: 47,821,268	C245*	probably null	Het
Zfp827	T	C	8: 79,061,183	V326A	probably benign	Het

Other mutations in Rims2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Rims2	APN	15	39459615	missense	probably benign	0.11
IGL00502:Rims2	APN	15	39506984	missense	probably damaging	1.00
IGL00556:Rims2	APN	15	39456674	splice site	probably null
IGL00811:Rims2	APN	15	39292149	missense	probably damaging	1.00
IGL00827:Rims2	APN	15	39472359	missense	probably damaging	0.99
IGL01642:Rims2	APN	15	39457796	missense	probably damaging	1.00
IGL02951:Rims2	APN	15	39534938	missense	probably damaging	1.00
IGL03009:Rims2	APN	15	39566997	missense	possibly damaging	0.85
IGL03080:Rims2	APN	15	39535903	missense	probably damaging	1.00
IGL03102:Rims2	APN	15	39459593	missense	possibly damaging	0.95
IGL03252:Rims2	APN	15	39452352	missense	probably benign
IGL03365:Rims2	APN	15	39476541	missense	probably damaging	1.00
IGL03393:Rims2	APN	15	39462613	splice site	probably null
IGL03409:Rims2	APN	15	39456733	missense	probably damaging	1.00
rhyme	UTSW	15	39452328	missense	probably damaging	1.00
PIT4486001:Rims2	UTSW	15	39476520	missense	possibly damaging	0.67
R0009:Rims2	UTSW	15	39534966	missense	probably damaging	0.99
R0009:Rims2	UTSW	15	39534966	missense	probably damaging	0.99
R0078:Rims2	UTSW	15	39534855	missense	probably benign	0.42
R0367:Rims2	UTSW	15	39462615	splice site	probably null
R0401:Rims2	UTSW	15	39509632	splice site	probably benign
R0531:Rims2	UTSW	15	39567030	missense	probably damaging	1.00
R0791:Rims2	UTSW	15	39679625	splice site	probably benign
R0838:Rims2	UTSW	15	39681025	missense	probably benign	0.02
R1201:Rims2	UTSW	15	39616324	missense	possibly damaging	0.91
R1318:Rims2	UTSW	15	39517826	missense	probably damaging	0.99
R1457:Rims2	UTSW	15	39511314	missense	possibly damaging	0.63
R1619:Rims2	UTSW	15	39506986	missense	probably damaging	1.00
R1672:Rims2	UTSW	15	39292189	missense	probably benign	0.09
R1743:Rims2	UTSW	15	39679650	missense	probably benign	0.10
R1766:Rims2	UTSW	15	39462580	missense	probably damaging	0.99
R1779:Rims2	UTSW	15	39681702	missense	probably damaging	1.00
R1804:Rims2	UTSW	15	39437043	nonsense	probably null
R1985:Rims2	UTSW	15	39345314	missense	probably damaging	0.99
R1986:Rims2	UTSW	15	39345314	missense	probably damaging	0.99
R2113:Rims2	UTSW	15	39511326	missense	probably benign	0.17
R2260:Rims2	UTSW	15	39478566	nonsense	probably null
R2510:Rims2	UTSW	15	39585652	missense	probably damaging	1.00
R3693:Rims2	UTSW	15	39478575	missense	probably benign	0.01
R3937:Rims2	UTSW	15	39437845	missense	probably damaging	1.00
R4425:Rims2	UTSW	15	39437924	critical splice donor site	probably null
R4453:Rims2	UTSW	15	39292208	missense	probably damaging	1.00
R4474:Rims2	UTSW	15	39462560	missense	probably damaging	1.00
R4518:Rims2	UTSW	15	39437526	missense	probably damaging	1.00
R4526:Rims2	UTSW	15	39437717	missense	probably damaging	1.00
R4833:Rims2	UTSW	15	39535914	missense	probably damaging	0.98
R4993:Rims2	UTSW	15	39454445	missense	possibly damaging	0.90
R5001:Rims2	UTSW	15	39452428	missense	probably benign	0.03
R5054:Rims2	UTSW	15	39517869	splice site	probably null
R5072:Rims2	UTSW	15	39462590	missense	probably benign	0.01
R5171:Rims2	UTSW	15	39437103	missense	probably damaging	1.00
R5429:Rims2	UTSW	15	39345355	missense	probably damaging	1.00
R5623:Rims2	UTSW	15	39478615	missense	probably damaging	1.00
R5624:Rims2	UTSW	15	39345413	missense	possibly damaging	0.46
R5685:Rims2	UTSW	15	39437206	missense	possibly damaging	0.67
R5784:Rims2	UTSW	15	39535987	splice site	probably null
R5790:Rims2	UTSW	15	39681045	missense	probably damaging	1.00
R5822:Rims2	UTSW	15	39476490	missense	probably damaging	1.00
R5963:Rims2	UTSW	15	39437182	missense	probably damaging	1.00
R5988:Rims2	UTSW	15	39292182	missense	probably damaging	1.00
R6057:Rims2	UTSW	15	39675020	missense	probably damaging	1.00
R6239:Rims2	UTSW	15	39198363	start codon destroyed	unknown
R6407:Rims2	UTSW	15	39452328	missense	probably damaging	1.00
R6418:Rims2	UTSW	15	39509696	missense	probably damaging	1.00
R6495:Rims2	UTSW	15	39517812	missense	probably benign	0.01
R6502:Rims2	UTSW	15	39534855	missense	probably benign	0.42
R6753:Rims2	UTSW	15	39566973	missense	possibly damaging	0.74
R6855:Rims2	UTSW	15	39345515	missense	probably benign	0.06
R6948:Rims2	UTSW	15	39511341	missense	probably benign
R7058:Rims2	UTSW	15	39585648	missense	probably damaging	1.00
R7167:Rims2	UTSW	15	39437077	missense	probably benign
R7217:Rims2	UTSW	15	39476489	missense	probably damaging	0.99
R7223:Rims2	UTSW	15	39437032	missense	probably benign	0.30
R7289:Rims2	UTSW	15	39437718	missense	probably benign	0.00
R7459:Rims2	UTSW	15	39517839	missense	probably benign
R7663:Rims2	UTSW	15	39507026	missense	probably damaging	1.00
R7792:Rims2	UTSW	15	39198528	missense	possibly damaging	0.69
R7836:Rims2	UTSW	15	39681079	missense	probably damaging	1.00
R8082:Rims2	UTSW	15	39476523	missense	probably benign	0.34
R8489:Rims2	UTSW	15	39616450	missense	probably damaging	1.00
R8730:Rims2	UTSW	15	39517843	missense	probably benign	0.01
R8830:Rims2	UTSW	15	39437362	missense	possibly damaging	0.64
R8857:Rims2	UTSW	15	39679648	missense	possibly damaging	0.95
R8893:Rims2	UTSW	15	39534954	missense	probably benign	0.02
R9010:Rims2	UTSW	15	39452390	nonsense	probably null
R9030:Rims2	UTSW	15	39476477	missense	probably damaging	1.00
R9287:Rims2	UTSW	15	39679690	missense	probably damaging	1.00
R9395:Rims2	UTSW	15	39292269	missense	probably damaging	1.00
R9451:Rims2	UTSW	15	39437328	missense	probably damaging	1.00
R9506:Rims2	UTSW	15	39472436	missense	probably damaging	0.97
X0034:Rims2	UTSW	15	39437534	missense	probably benign
Z1177:Rims2	UTSW	15	39437769	missense	probably benign	0.24
Z1177:Rims2	UTSW	15	39478690	frame shift	probably null
Z1177:Rims2	UTSW	15	39681114	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGTAGAGCTGCAATGGAAAACC -3'
(R):5'- GCTCCACATCATCACAGCTTG -3'

Sequencing Primer
(F):5'- GAGGCTCAGGGACAAAGTTCTTATC -3'
(R):5'- CATCACAGCTTGTATACTCAGGTGTG -3'

Posted On

2016-04-15