Incidental Mutation 'R4936:Espl1'
ID 380409
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Name extra spindle pole bodies 1, separase
Synonyms ESP1, SSE, separase, PRCE, Cerp, PRCE
MMRRC Submission 042536-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4936 (G1)
Quality Score 138
Status Not validated
Chromosome 15
Chromosomal Location 102204701-102232792 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 102213372 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 566 (D566V)
Ref Sequence ENSEMBL: ENSMUSP00000155304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]
AlphaFold P60330
Predicted Effect probably damaging
Transcript: ENSMUST00000064924
AA Change: D566V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: D566V

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229050
AA Change: D566V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230120
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,879,212 (GRCm39) F183L possibly damaging Het
4930590J08Rik T A 6: 91,921,245 (GRCm39) M775K probably damaging Het
Actn1 T G 12: 80,219,772 (GRCm39) I700L probably benign Het
Adam5 T C 8: 25,276,287 (GRCm39) Y460C probably damaging Het
Akna C T 4: 63,313,502 (GRCm39) G207E probably damaging Het
Ank2 T A 3: 126,748,688 (GRCm39) H527L possibly damaging Het
Anks1 C A 17: 28,207,779 (GRCm39) N383K probably damaging Het
Apba3 C T 10: 81,105,204 (GRCm39) probably null Het
Atp9b C A 18: 80,779,308 (GRCm39) V1121F possibly damaging Het
Bsn T C 9: 107,988,960 (GRCm39) Y2264C probably damaging Het
Bst1 A G 5: 43,997,799 (GRCm39) D266G probably damaging Het
Cep55 A G 19: 38,060,202 (GRCm39) probably null Het
Ces4a G A 8: 105,864,729 (GRCm39) G69S probably damaging Het
Ckb T C 12: 111,637,664 (GRCm39) K156E probably benign Het
Cln3 T A 7: 126,174,393 (GRCm39) H315L probably damaging Het
Cnot6l A G 5: 96,227,796 (GRCm39) F479S probably damaging Het
Col1a1 A G 11: 94,837,958 (GRCm39) D826G unknown Het
Cyp27a1 T C 1: 74,774,564 (GRCm39) V194A probably benign Het
Dis3l2 C T 1: 86,971,890 (GRCm39) P643S probably benign Het
Dpf3 T C 12: 83,378,740 (GRCm39) D108G probably damaging Het
Eif2b4 C T 5: 31,350,241 (GRCm39) G27D probably benign Het
Eif4a1 T G 11: 69,563,251 (GRCm39) probably benign Het
Ext2 T A 2: 93,644,024 (GRCm39) R86* probably null Het
Fasn A T 11: 120,706,911 (GRCm39) F914I probably damaging Het
Fbf1 A G 11: 116,043,378 (GRCm39) L477P probably benign Het
Fsd1 A T 17: 56,303,452 (GRCm39) K441N possibly damaging Het
Fsip2 T A 2: 82,815,384 (GRCm39) S3706T probably benign Het
Gabra5 A T 7: 57,058,547 (GRCm39) N400K probably benign Het
Gimap8 G T 6: 48,633,068 (GRCm39) G296W probably damaging Het
Gli2 A G 1: 118,763,870 (GRCm39) V1427A probably benign Het
Gm7334 A T 17: 51,005,855 (GRCm39) Y47F probably damaging Het
Gm8674 T G 13: 50,054,791 (GRCm39) noncoding transcript Het
Gmeb2 G T 2: 180,896,039 (GRCm39) T377K probably benign Het
Gp9 T A 6: 87,756,229 (GRCm39) D81E probably benign Het
Il5ra T A 6: 106,715,123 (GRCm39) I212F possibly damaging Het
Klhl18 G T 9: 110,258,029 (GRCm39) N470K possibly damaging Het
Lfng G T 5: 140,598,150 (GRCm39) probably null Het
Lpo A G 11: 87,701,166 (GRCm39) I430T probably benign Het
Lrrc31 C T 3: 30,743,417 (GRCm39) D183N probably damaging Het
Meis2 T C 2: 115,694,893 (GRCm39) T410A probably benign Het
Myo6 A G 9: 80,214,963 (GRCm39) D1232G probably damaging Het
Ncapd2 C T 6: 125,146,803 (GRCm39) R1261H probably benign Het
Nfkb1 C T 3: 135,319,743 (GRCm39) V251M probably damaging Het
Nmbr C A 10: 14,642,730 (GRCm39) H96Q probably damaging Het
Nop14 C T 5: 34,809,737 (GRCm39) R256H probably damaging Het
Nqo2 T A 13: 34,165,501 (GRCm39) Y133N probably damaging Het
Or1f12 T C 13: 21,721,357 (GRCm39) I273V probably benign Het
Or5w20 A G 2: 87,727,157 (GRCm39) I213V probably benign Het
Pbld2 C A 10: 62,888,017 (GRCm39) S168R probably damaging Het
Pcdhb7 G T 18: 37,475,203 (GRCm39) G113V probably damaging Het
Pcdhb7 G T 18: 37,475,202 (GRCm39) G113* probably null Het
Pdgfra A T 5: 75,355,687 (GRCm39) T1066S probably damaging Het
Prdm8 A T 5: 98,332,881 (GRCm39) probably null Het
Prdm8 G T 5: 98,332,882 (GRCm39) probably null Het
Prkg1 T C 19: 30,563,775 (GRCm39) Y479C probably benign Het
Pudp T C 18: 50,701,539 (GRCm39) T65A probably benign Het
Rbbp6 C T 7: 122,598,926 (GRCm39) probably benign Het
Rcc1 C G 4: 132,063,046 (GRCm39) V187L probably damaging Het
Rims2 T A 15: 39,301,124 (GRCm39) M285K probably damaging Het
Rtkn2 T C 10: 67,877,745 (GRCm39) *602Q probably null Het
Rxfp3 T G 15: 11,036,866 (GRCm39) S169R probably damaging Het
Sardh T C 2: 27,118,253 (GRCm39) probably null Het
Slc24a2 A T 4: 87,145,584 (GRCm39) F157I probably damaging Het
Slc25a20 T C 9: 108,559,191 (GRCm39) Y186H probably damaging Het
Slc25a24 A G 3: 109,070,864 (GRCm39) R408G probably damaging Het
Slc44a5 T G 3: 153,959,353 (GRCm39) I348S probably damaging Het
Slc8a2 A T 7: 15,868,100 (GRCm39) K111* probably null Het
Smc5 A G 19: 23,211,367 (GRCm39) V589A probably damaging Het
Thbd A T 2: 148,249,655 (GRCm39) I71N probably damaging Het
Thsd7b T C 1: 129,605,882 (GRCm39) M541T probably benign Het
Tie1 T A 4: 118,341,968 (GRCm39) silent Het
Tln1 A G 4: 43,547,522 (GRCm39) F813S possibly damaging Het
Tnrc18 A T 5: 142,751,732 (GRCm39) L1191* probably null Het
Tubb2a A C 13: 34,259,240 (GRCm39) Y183* probably null Het
Ubr4 T A 4: 139,123,877 (GRCm39) V343E probably damaging Het
Vmn2r93 A T 17: 18,524,327 (GRCm39) D107V possibly damaging Het
Vwa5a T G 9: 38,647,494 (GRCm39) S624R probably benign Het
Wwox G A 8: 115,433,098 (GRCm39) V255I probably benign Het
Wwp1 T C 4: 19,638,804 (GRCm39) K546E probably damaging Het
Xirp2 T A 2: 67,340,163 (GRCm39) F801L possibly damaging Het
Zfp407 T C 18: 84,577,589 (GRCm39) I1175V probably benign Het
Zfp646 T A 7: 127,480,933 (GRCm39) C1037S possibly damaging Het
Zfp786 A T 6: 47,798,202 (GRCm39) C245* probably null Het
Zfp827 T C 8: 79,787,812 (GRCm39) V326A probably benign Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102,208,248 (GRCm39) missense probably damaging 1.00
IGL00839:Espl1 APN 15 102,228,982 (GRCm39) unclassified probably benign
IGL00919:Espl1 APN 15 102,207,064 (GRCm39) missense probably benign 0.03
IGL01125:Espl1 APN 15 102,231,373 (GRCm39) missense probably damaging 1.00
IGL01366:Espl1 APN 15 102,228,271 (GRCm39) missense probably benign 0.00
IGL01488:Espl1 APN 15 102,207,174 (GRCm39) missense probably benign
IGL01554:Espl1 APN 15 102,221,660 (GRCm39) missense probably damaging 1.00
IGL01810:Espl1 APN 15 102,206,640 (GRCm39) missense probably benign
IGL01959:Espl1 APN 15 102,214,097 (GRCm39) splice site probably benign
IGL02267:Espl1 APN 15 102,224,099 (GRCm39) missense probably benign 0.01
IGL02452:Espl1 APN 15 102,208,274 (GRCm39) missense probably damaging 1.00
IGL02469:Espl1 APN 15 102,222,460 (GRCm39) missense probably damaging 1.00
IGL02500:Espl1 APN 15 102,224,235 (GRCm39) missense probably benign
IGL02630:Espl1 APN 15 102,205,253 (GRCm39) missense probably benign 0.11
IGL02687:Espl1 APN 15 102,221,613 (GRCm39) splice site probably benign
IGL02868:Espl1 APN 15 102,222,425 (GRCm39) nonsense probably null
IGL02926:Espl1 APN 15 102,208,290 (GRCm39) missense probably damaging 0.99
R0019:Espl1 UTSW 15 102,214,754 (GRCm39) missense probably null 0.01
R0129:Espl1 UTSW 15 102,225,083 (GRCm39) missense probably benign 0.00
R0184:Espl1 UTSW 15 102,207,651 (GRCm39) missense probably benign 0.01
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0267:Espl1 UTSW 15 102,221,452 (GRCm39) missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102,212,421 (GRCm39) nonsense probably null
R0587:Espl1 UTSW 15 102,212,382 (GRCm39) splice site probably benign
R0726:Espl1 UTSW 15 102,231,033 (GRCm39) missense probably benign
R1186:Espl1 UTSW 15 102,212,474 (GRCm39) missense probably benign 0.05
R1282:Espl1 UTSW 15 102,223,826 (GRCm39) missense probably benign 0.00
R1428:Espl1 UTSW 15 102,214,120 (GRCm39) missense probably benign 0.06
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1473:Espl1 UTSW 15 102,228,878 (GRCm39) missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102,206,802 (GRCm39) missense probably damaging 0.98
R1639:Espl1 UTSW 15 102,229,149 (GRCm39) missense probably damaging 1.00
R1725:Espl1 UTSW 15 102,221,656 (GRCm39) missense probably benign 0.08
R1748:Espl1 UTSW 15 102,206,964 (GRCm39) missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102,207,448 (GRCm39) missense probably benign
R1938:Espl1 UTSW 15 102,213,477 (GRCm39) missense probably benign 0.00
R1954:Espl1 UTSW 15 102,206,823 (GRCm39) missense probably damaging 1.00
R2009:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2014:Espl1 UTSW 15 102,231,149 (GRCm39) nonsense probably null
R2067:Espl1 UTSW 15 102,207,525 (GRCm39) missense probably damaging 0.96
R2084:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R2164:Espl1 UTSW 15 102,228,023 (GRCm39) missense probably damaging 1.00
R2204:Espl1 UTSW 15 102,214,340 (GRCm39) missense probably damaging 1.00
R2220:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2237:Espl1 UTSW 15 102,224,004 (GRCm39) missense probably damaging 0.98
R2314:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3107:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3108:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3114:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3616:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3733:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3958:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3959:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3960:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4062:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4063:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4064:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4165:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4166:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4349:Espl1 UTSW 15 102,228,039 (GRCm39) missense probably benign 0.26
R4373:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4376:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4377:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4516:Espl1 UTSW 15 102,231,671 (GRCm39) missense probably benign 0.00
R4595:Espl1 UTSW 15 102,207,159 (GRCm39) missense probably benign 0.01
R4884:Espl1 UTSW 15 102,232,505 (GRCm39) missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102,230,758 (GRCm39) critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102,223,676 (GRCm39) missense probably damaging 0.98
R4931:Espl1 UTSW 15 102,214,165 (GRCm39) missense probably benign 0.02
R5000:Espl1 UTSW 15 102,206,986 (GRCm39) missense probably damaging 1.00
R5220:Espl1 UTSW 15 102,207,012 (GRCm39) missense probably benign 0.03
R5329:Espl1 UTSW 15 102,220,953 (GRCm39) missense probably damaging 0.97
R5501:Espl1 UTSW 15 102,225,565 (GRCm39) missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102,232,465 (GRCm39) missense probably damaging 1.00
R5848:Espl1 UTSW 15 102,231,011 (GRCm39) missense probably benign 0.03
R5906:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R5978:Espl1 UTSW 15 102,224,209 (GRCm39) missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102,208,323 (GRCm39) missense probably damaging 0.99
R6313:Espl1 UTSW 15 102,224,247 (GRCm39) missense probably benign 0.00
R6414:Espl1 UTSW 15 102,223,995 (GRCm39) missense probably damaging 0.96
R6484:Espl1 UTSW 15 102,231,935 (GRCm39) missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102,207,660 (GRCm39) missense probably benign
R6928:Espl1 UTSW 15 102,207,342 (GRCm39) missense probably benign 0.28
R6995:Espl1 UTSW 15 102,212,535 (GRCm39) missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102,225,328 (GRCm39) critical splice donor site probably null
R7062:Espl1 UTSW 15 102,207,331 (GRCm39) missense probably benign 0.00
R7135:Espl1 UTSW 15 102,227,959 (GRCm39) nonsense probably null
R7154:Espl1 UTSW 15 102,232,484 (GRCm39) missense probably damaging 1.00
R7164:Espl1 UTSW 15 102,221,638 (GRCm39) missense probably damaging 1.00
R7522:Espl1 UTSW 15 102,213,486 (GRCm39) missense probably damaging 1.00
R7848:Espl1 UTSW 15 102,224,961 (GRCm39) missense probably damaging 1.00
R7894:Espl1 UTSW 15 102,212,460 (GRCm39) missense probably damaging 1.00
R8275:Espl1 UTSW 15 102,211,188 (GRCm39) splice site probably benign
R8752:Espl1 UTSW 15 102,214,759 (GRCm39) missense probably damaging 1.00
R9160:Espl1 UTSW 15 102,206,953 (GRCm39) missense probably damaging 1.00
R9310:Espl1 UTSW 15 102,205,285 (GRCm39) critical splice donor site probably null
R9385:Espl1 UTSW 15 102,207,185 (GRCm39) missense probably damaging 0.99
R9532:Espl1 UTSW 15 102,228,260 (GRCm39) nonsense probably null
R9563:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9565:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9723:Espl1 UTSW 15 102,229,170 (GRCm39) missense probably benign 0.43
X0062:Espl1 UTSW 15 102,206,832 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGGTTTTATAGGCCGTG -3'
(R):5'- CTGGGTAAAGTTGTGGTAGCAC -3'

Sequencing Primer
(F):5'- ATAGGCCGTGGTACAGGTTTG -3'
(R):5'- TGGTAGCACAGCACTTGG -3'
Posted On 2016-04-15