Incidental Mutation 'R4936:Espl1'
ID380409
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Nameextra spindle pole bodies 1, separase
SynonymsSSE, ESP1, PRCE, Cerp, PRCE, separase
MMRRC Submission 042536-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4936 (G1)
Quality Score138
Status Not validated
Chromosome15
Chromosomal Location102296266-102324357 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102304937 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 566 (D566V)
Ref Sequence ENSEMBL: ENSMUSP00000155304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]
Predicted Effect probably damaging
Transcript: ENSMUST00000064924
AA Change: D566V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: D566V

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229050
AA Change: D566V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230120
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,315 F183L possibly damaging Het
4930590J08Rik T A 6: 91,944,264 M775K probably damaging Het
Actn1 T G 12: 80,172,998 I700L probably benign Het
Adam5 T C 8: 24,786,271 Y460C probably damaging Het
Akna C T 4: 63,395,265 G207E probably damaging Het
Ank2 T A 3: 126,955,039 H527L possibly damaging Het
Anks1 C A 17: 27,988,805 N383K probably damaging Het
Apba3 C T 10: 81,269,370 probably null Het
Atp9b C A 18: 80,736,093 V1121F possibly damaging Het
Bsn T C 9: 108,111,761 Y2264C probably damaging Het
Bst1 A G 5: 43,840,457 D266G probably damaging Het
Cep55 A G 19: 38,071,754 probably null Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Ckb T C 12: 111,671,230 K156E probably benign Het
Cln3 T A 7: 126,575,221 H315L probably damaging Het
Cnot6l A G 5: 96,079,937 F479S probably damaging Het
Col1a1 A G 11: 94,947,132 D826G unknown Het
Cyp27a1 T C 1: 74,735,405 V194A probably benign Het
Dis3l2 C T 1: 87,044,168 P643S probably benign Het
Dpf3 T C 12: 83,331,966 D108G probably damaging Het
Eif2b4 C T 5: 31,192,897 G27D probably benign Het
Eif4a1 T G 11: 69,672,425 probably benign Het
Ext2 T A 2: 93,813,679 R86* probably null Het
Fasn A T 11: 120,816,085 F914I probably damaging Het
Fbf1 A G 11: 116,152,552 L477P probably benign Het
Fsd1 A T 17: 55,996,452 K441N possibly damaging Het
Fsip2 T A 2: 82,985,040 S3706T probably benign Het
Gabra5 A T 7: 57,408,799 N400K probably benign Het
Gimap8 G T 6: 48,656,134 G296W probably damaging Het
Gli2 A G 1: 118,836,140 V1427A probably benign Het
Gm7334 A T 17: 50,698,827 Y47F probably damaging Het
Gm8674 T G 13: 49,900,755 noncoding transcript Het
Gmeb2 G T 2: 181,254,246 T377K probably benign Het
Gp9 T A 6: 87,779,247 D81E probably benign Het
Il5ra T A 6: 106,738,162 I212F possibly damaging Het
Klhl18 G T 9: 110,428,961 N470K possibly damaging Het
Lfng G T 5: 140,612,395 probably null Het
Lpo A G 11: 87,810,340 I430T probably benign Het
Lrrc31 C T 3: 30,689,268 D183N probably damaging Het
Meis2 T C 2: 115,864,412 T410A probably benign Het
Myo6 A G 9: 80,307,681 D1232G probably damaging Het
Ncapd2 C T 6: 125,169,840 R1261H probably benign Het
Nfkb1 C T 3: 135,613,982 V251M probably damaging Het
Nmbr C A 10: 14,766,986 H96Q probably damaging Het
Nop14 C T 5: 34,652,393 R256H probably damaging Het
Nqo2 T A 13: 33,981,518 Y133N probably damaging Het
Olfr1153 A G 2: 87,896,813 I213V probably benign Het
Olfr1366 T C 13: 21,537,187 I273V probably benign Het
Pbld2 C A 10: 63,052,238 S168R probably damaging Het
Pcdhb7 G T 18: 37,342,149 G113* probably null Het
Pcdhb7 G T 18: 37,342,150 G113V probably damaging Het
Pdgfra A T 5: 75,195,026 T1066S probably damaging Het
Prdm8 A T 5: 98,185,022 probably null Het
Prdm8 G T 5: 98,185,023 probably null Het
Prkg1 T C 19: 30,586,375 Y479C probably benign Het
Pudp T C 18: 50,568,468 T65A probably benign Het
Rbbp6 C T 7: 122,999,703 probably benign Het
Rcc1 C G 4: 132,335,735 V187L probably damaging Het
Rims2 T A 15: 39,437,728 M285K probably damaging Het
Rtkn2 T C 10: 68,041,915 *602Q probably null Het
Rxfp3 T G 15: 11,036,780 S169R probably damaging Het
Sardh T C 2: 27,228,241 probably null Het
Slc24a2 A T 4: 87,227,347 F157I probably damaging Het
Slc25a20 T C 9: 108,681,992 Y186H probably damaging Het
Slc25a24 A G 3: 109,163,548 R408G probably damaging Het
Slc44a5 T G 3: 154,253,716 I348S probably damaging Het
Slc8a2 A T 7: 16,134,175 K111* probably null Het
Smc5 A G 19: 23,234,003 V589A probably damaging Het
Thbd A T 2: 148,407,735 I71N probably damaging Het
Thsd7b T C 1: 129,678,145 M541T probably benign Het
Tie1 T A 4: 118,484,771 silent Het
Tln1 A G 4: 43,547,522 F813S possibly damaging Het
Tnrc18 A T 5: 142,765,977 L1191* probably null Het
Tubb2a A C 13: 34,075,257 Y183* probably null Het
Ubr4 T A 4: 139,396,566 V343E probably damaging Het
Vmn2r93 A T 17: 18,304,065 D107V possibly damaging Het
Vwa5a T G 9: 38,736,198 S624R probably benign Het
Wwox G A 8: 114,706,358 V255I probably benign Het
Wwp1 T C 4: 19,638,804 K546E probably damaging Het
Xirp2 T A 2: 67,509,819 F801L possibly damaging Het
Zfp407 T C 18: 84,559,464 I1175V probably benign Het
Zfp646 T A 7: 127,881,761 C1037S possibly damaging Het
Zfp786 A T 6: 47,821,268 C245* probably null Het
Zfp827 T C 8: 79,061,183 V326A probably benign Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102299813 missense probably damaging 1.00
IGL00839:Espl1 APN 15 102320547 unclassified probably benign
IGL00919:Espl1 APN 15 102298629 missense probably benign 0.03
IGL01125:Espl1 APN 15 102322938 missense probably damaging 1.00
IGL01366:Espl1 APN 15 102319836 missense probably benign 0.00
IGL01488:Espl1 APN 15 102298739 missense probably benign
IGL01554:Espl1 APN 15 102313225 missense probably damaging 1.00
IGL01810:Espl1 APN 15 102298205 missense probably benign
IGL01959:Espl1 APN 15 102305662 splice site probably benign
IGL02267:Espl1 APN 15 102315664 missense probably benign 0.01
IGL02452:Espl1 APN 15 102299839 missense probably damaging 1.00
IGL02469:Espl1 APN 15 102314025 missense probably damaging 1.00
IGL02500:Espl1 APN 15 102315800 missense probably benign
IGL02630:Espl1 APN 15 102296818 missense probably benign 0.11
IGL02687:Espl1 APN 15 102313178 splice site probably benign
IGL02868:Espl1 APN 15 102313990 nonsense probably null
IGL02926:Espl1 APN 15 102299855 missense probably damaging 0.99
R0019:Espl1 UTSW 15 102306319 missense probably null 0.01
R0129:Espl1 UTSW 15 102316648 missense probably benign 0.00
R0184:Espl1 UTSW 15 102299216 missense probably benign 0.01
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0267:Espl1 UTSW 15 102313017 missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102303986 nonsense probably null
R0587:Espl1 UTSW 15 102303947 splice site probably benign
R0726:Espl1 UTSW 15 102322598 missense probably benign
R1186:Espl1 UTSW 15 102304039 missense probably benign 0.05
R1282:Espl1 UTSW 15 102315391 missense probably benign 0.00
R1428:Espl1 UTSW 15 102305685 missense probably benign 0.06
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1473:Espl1 UTSW 15 102320443 missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102298367 missense probably damaging 0.98
R1639:Espl1 UTSW 15 102320714 missense probably damaging 1.00
R1725:Espl1 UTSW 15 102313221 missense probably benign 0.08
R1748:Espl1 UTSW 15 102298529 missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102299013 missense probably benign
R1938:Espl1 UTSW 15 102305042 missense probably benign 0.00
R1954:Espl1 UTSW 15 102298388 missense probably damaging 1.00
R2009:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2014:Espl1 UTSW 15 102322714 nonsense probably null
R2067:Espl1 UTSW 15 102299090 missense probably damaging 0.96
R2084:Espl1 UTSW 15 102296851 critical splice donor site probably null
R2164:Espl1 UTSW 15 102319588 missense probably damaging 1.00
R2204:Espl1 UTSW 15 102305905 missense probably damaging 1.00
R2220:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2237:Espl1 UTSW 15 102315569 missense probably damaging 0.98
R2314:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3107:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3108:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3114:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3616:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3733:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3958:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3959:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3960:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4062:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4063:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4064:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4165:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4166:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4349:Espl1 UTSW 15 102319604 missense probably benign 0.26
R4373:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4376:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4377:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4516:Espl1 UTSW 15 102323236 missense probably benign 0.00
R4595:Espl1 UTSW 15 102298724 missense probably benign 0.01
R4884:Espl1 UTSW 15 102324070 missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102322323 critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102315241 missense probably damaging 0.98
R4931:Espl1 UTSW 15 102305730 missense probably benign 0.02
R5000:Espl1 UTSW 15 102298551 missense probably damaging 1.00
R5220:Espl1 UTSW 15 102298577 missense probably benign 0.03
R5329:Espl1 UTSW 15 102312518 missense probably damaging 0.97
R5501:Espl1 UTSW 15 102317130 missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102324030 missense probably damaging 1.00
R5848:Espl1 UTSW 15 102322576 missense probably benign 0.03
R5906:Espl1 UTSW 15 102296851 critical splice donor site probably null
R5978:Espl1 UTSW 15 102315774 missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102299888 missense probably damaging 0.99
R6313:Espl1 UTSW 15 102315812 missense probably benign 0.00
R6414:Espl1 UTSW 15 102315560 missense probably damaging 0.96
R6484:Espl1 UTSW 15 102323500 missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102299225 missense probably benign
R6928:Espl1 UTSW 15 102298907 missense probably benign 0.28
R6995:Espl1 UTSW 15 102304100 missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102316893 critical splice donor site probably null
R7062:Espl1 UTSW 15 102298896 missense probably benign 0.00
R7135:Espl1 UTSW 15 102319524 nonsense probably null
R7154:Espl1 UTSW 15 102324049 missense probably damaging 1.00
R7164:Espl1 UTSW 15 102313203 missense probably damaging 1.00
R7522:Espl1 UTSW 15 102305051 missense probably damaging 1.00
R7848:Espl1 UTSW 15 102316526 missense probably damaging 1.00
R7894:Espl1 UTSW 15 102304025 missense probably damaging 1.00
X0062:Espl1 UTSW 15 102298397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGGTTTTATAGGCCGTG -3'
(R):5'- CTGGGTAAAGTTGTGGTAGCAC -3'

Sequencing Primer
(F):5'- ATAGGCCGTGGTACAGGTTTG -3'
(R):5'- TGGTAGCACAGCACTTGG -3'
Posted On2016-04-15