Mutagenetix > Incidental Mutation

Incidental Mutation 'R4936:Espl1'

380409

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

042536-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4936 (G1)

Quality Score

138

Status

Not validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 102304937 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 566 (D566V)

Ref Sequence

ENSEMBL: ENSMUSP00000155304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]

AlphaFold

P60330

Predicted Effect

probably damaging
Transcript: ENSMUST00000064924
AA Change: D566V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: D566V

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000229050
AA Change: D566V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230120

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.0%
20x: 87.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300002M23Rik	T	A	17: 35,568,315	F183L	possibly damaging	Het
4930590J08Rik	T	A	6: 91,944,264	M775K	probably damaging	Het
Actn1	T	G	12: 80,172,998	I700L	probably benign	Het
Adam5	T	C	8: 24,786,271	Y460C	probably damaging	Het
Akna	C	T	4: 63,395,265	G207E	probably damaging	Het
Ank2	T	A	3: 126,955,039	H527L	possibly damaging	Het
Anks1	C	A	17: 27,988,805	N383K	probably damaging	Het
Apba3	C	T	10: 81,269,370		probably null	Het
Atp9b	C	A	18: 80,736,093	V1121F	possibly damaging	Het
Bsn	T	C	9: 108,111,761	Y2264C	probably damaging	Het
Bst1	A	G	5: 43,840,457	D266G	probably damaging	Het
Cep55	A	G	19: 38,071,754		probably null	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Ckb	T	C	12: 111,671,230	K156E	probably benign	Het
Cln3	T	A	7: 126,575,221	H315L	probably damaging	Het
Cnot6l	A	G	5: 96,079,937	F479S	probably damaging	Het
Col1a1	A	G	11: 94,947,132	D826G	unknown	Het
Cyp27a1	T	C	1: 74,735,405	V194A	probably benign	Het
Dis3l2	C	T	1: 87,044,168	P643S	probably benign	Het
Dpf3	T	C	12: 83,331,966	D108G	probably damaging	Het
Eif2b4	C	T	5: 31,192,897	G27D	probably benign	Het
Eif4a1	T	G	11: 69,672,425		probably benign	Het
Ext2	T	A	2: 93,813,679	R86*	probably null	Het
Fasn	A	T	11: 120,816,085	F914I	probably damaging	Het
Fbf1	A	G	11: 116,152,552	L477P	probably benign	Het
Fsd1	A	T	17: 55,996,452	K441N	possibly damaging	Het
Fsip2	T	A	2: 82,985,040	S3706T	probably benign	Het
Gabra5	A	T	7: 57,408,799	N400K	probably benign	Het
Gimap8	G	T	6: 48,656,134	G296W	probably damaging	Het
Gli2	A	G	1: 118,836,140	V1427A	probably benign	Het
Gm7334	A	T	17: 50,698,827	Y47F	probably damaging	Het
Gm8674	T	G	13: 49,900,755		noncoding transcript	Het
Gmeb2	G	T	2: 181,254,246	T377K	probably benign	Het
Gp9	T	A	6: 87,779,247	D81E	probably benign	Het
Il5ra	T	A	6: 106,738,162	I212F	possibly damaging	Het
Klhl18	G	T	9: 110,428,961	N470K	possibly damaging	Het
Lfng	G	T	5: 140,612,395		probably null	Het
Lpo	A	G	11: 87,810,340	I430T	probably benign	Het
Lrrc31	C	T	3: 30,689,268	D183N	probably damaging	Het
Meis2	T	C	2: 115,864,412	T410A	probably benign	Het
Myo6	A	G	9: 80,307,681	D1232G	probably damaging	Het
Ncapd2	C	T	6: 125,169,840	R1261H	probably benign	Het
Nfkb1	C	T	3: 135,613,982	V251M	probably damaging	Het
Nmbr	C	A	10: 14,766,986	H96Q	probably damaging	Het
Nop14	C	T	5: 34,652,393	R256H	probably damaging	Het
Nqo2	T	A	13: 33,981,518	Y133N	probably damaging	Het
Olfr1153	A	G	2: 87,896,813	I213V	probably benign	Het
Olfr1366	T	C	13: 21,537,187	I273V	probably benign	Het
Pbld2	C	A	10: 63,052,238	S168R	probably damaging	Het
Pcdhb7	G	T	18: 37,342,149	G113*	probably null	Het
Pcdhb7	G	T	18: 37,342,150	G113V	probably damaging	Het
Pdgfra	A	T	5: 75,195,026	T1066S	probably damaging	Het
Prdm8	G	T	5: 98,185,023		probably null	Het
Prdm8	A	T	5: 98,185,022		probably null	Het
Prkg1	T	C	19: 30,586,375	Y479C	probably benign	Het
Pudp	T	C	18: 50,568,468	T65A	probably benign	Het
Rbbp6	C	T	7: 122,999,703		probably benign	Het
Rcc1	C	G	4: 132,335,735	V187L	probably damaging	Het
Rims2	T	A	15: 39,437,728	M285K	probably damaging	Het
Rtkn2	T	C	10: 68,041,915	*602Q	probably null	Het
Rxfp3	T	G	15: 11,036,780	S169R	probably damaging	Het
Sardh	T	C	2: 27,228,241		probably null	Het
Slc24a2	A	T	4: 87,227,347	F157I	probably damaging	Het
Slc25a20	T	C	9: 108,681,992	Y186H	probably damaging	Het
Slc25a24	A	G	3: 109,163,548	R408G	probably damaging	Het
Slc44a5	T	G	3: 154,253,716	I348S	probably damaging	Het
Slc8a2	A	T	7: 16,134,175	K111*	probably null	Het
Smc5	A	G	19: 23,234,003	V589A	probably damaging	Het
Thbd	A	T	2: 148,407,735	I71N	probably damaging	Het
Thsd7b	T	C	1: 129,678,145	M541T	probably benign	Het
Tie1	T	A	4: 118,484,771		silent	Het
Tln1	A	G	4: 43,547,522	F813S	possibly damaging	Het
Tnrc18	A	T	5: 142,765,977	L1191*	probably null	Het
Tubb2a	A	C	13: 34,075,257	Y183*	probably null	Het
Ubr4	T	A	4: 139,396,566	V343E	probably damaging	Het
Vmn2r93	A	T	17: 18,304,065	D107V	possibly damaging	Het
Vwa5a	T	G	9: 38,736,198	S624R	probably benign	Het
Wwox	G	A	8: 114,706,358	V255I	probably benign	Het
Wwp1	T	C	4: 19,638,804	K546E	probably damaging	Het
Xirp2	T	A	2: 67,509,819	F801L	possibly damaging	Het
Zfp407	T	C	18: 84,559,464	I1175V	probably benign	Het
Zfp646	T	A	7: 127,881,761	C1037S	possibly damaging	Het
Zfp786	A	T	6: 47,821,268	C245*	probably null	Het
Zfp827	T	C	8: 79,061,183	V326A	probably benign	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGGGTTTTATAGGCCGTG -3'
(R):5'- CTGGGTAAAGTTGTGGTAGCAC -3'

Sequencing Primer
(F):5'- ATAGGCCGTGGTACAGGTTTG -3'
(R):5'- TGGTAGCACAGCACTTGG -3'

Posted On

2016-04-15