Incidental Mutation 'R0399:AI314180'
ID38042
Institutional Source Beutler Lab
Gene Symbol AI314180
Ensembl Gene ENSMUSG00000050812
Gene Nameexpressed sequence AI314180
Synonyms
MMRRC Submission 038604-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock #R0399 (G1)
Quality Score168
Status Validated
Chromosome4
Chromosomal Location58798911-58912749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58827047 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1029 (T1029A)
Ref Sequence ENSEMBL: ENSMUSP00000099953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102889] [ENSMUST00000107557] [ENSMUST00000149301]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102889
AA Change: T1029A

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099953
Gene: ENSMUSG00000050812
AA Change: T1029A

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 1.1e-155 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1491 3e-31 SMART
low complexity region 1781 1797 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107557
SMART Domains Protein: ENSMUSP00000103182
Gene: ENSMUSG00000050812

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 7.6e-164 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135601
Predicted Effect probably benign
Transcript: ENSMUST00000149301
AA Change: T1029A

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000117585
Gene: ENSMUSG00000050812
AA Change: T1029A

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 4e-163 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1490 8e-32 SMART
Meta Mutation Damage Score 0.0755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 99% (71/72)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,750,959 probably benign Het
6030452D12Rik T C 8: 106,504,542 M120T unknown Het
Actr1a A T 19: 46,385,011 probably null Het
Anapc5 A T 5: 122,791,753 V555D probably damaging Het
Aox1 A G 1: 58,068,849 probably null Het
Arhgap30 A G 1: 171,404,816 E343G probably damaging Het
Asap2 C T 12: 21,217,997 T291I possibly damaging Het
Atp5a1 T A 18: 77,781,836 Y439* probably null Het
Auts2 A T 5: 131,440,524 S428T probably benign Het
B3gnt7 T A 1: 86,305,711 C109* probably null Het
C4b C A 17: 34,728,869 Q1657H probably damaging Het
Cadm2 A T 16: 66,747,339 L268* probably null Het
Cep290 G A 10: 100,554,400 probably benign Het
Cep68 T G 11: 20,230,571 I687L probably benign Het
Chd6 T A 2: 161,052,688 D84V probably damaging Het
Clpx A G 9: 65,322,769 T514A probably benign Het
Cox18 A T 5: 90,215,028 C324S probably benign Het
Cryzl2 T C 1: 157,462,016 Y75H probably damaging Het
Cxcr6 C T 9: 123,810,951 A339V possibly damaging Het
Dock1 T C 7: 135,163,442 L1721P probably benign Het
Dstyk T C 1: 132,453,080 probably benign Het
Ehf A G 2: 103,266,870 Y246H probably damaging Het
Epas1 T C 17: 86,805,193 V73A probably benign Het
Filip1 A G 9: 79,818,310 I1009T possibly damaging Het
Glis3 A T 19: 28,298,768 probably benign Het
Gm17333 A T 16: 77,852,790 noncoding transcript Het
Gpc1 G A 1: 92,857,309 R358H possibly damaging Het
Gpr155 A T 2: 73,370,002 I387N possibly damaging Het
Gria1 A G 11: 57,186,027 D83G probably damaging Het
Grid2 A G 6: 64,666,052 I933V probably benign Het
Hhatl C T 9: 121,788,762 A254T probably benign Het
Hook2 A G 8: 84,993,567 probably benign Het
Ift140 T A 17: 25,050,340 S656R possibly damaging Het
Il11ra1 A T 4: 41,766,185 T241S probably benign Het
Kank1 A G 19: 25,411,242 I760V probably benign Het
Kansl1 T C 11: 104,424,132 E360G possibly damaging Het
Klf9 A T 19: 23,142,082 S110C probably damaging Het
Klhl31 A G 9: 77,650,653 N217S probably benign Het
Lct T C 1: 128,300,525 Y1077C probably damaging Het
Lrrc49 A T 9: 60,610,246 probably benign Het
Lrrn1 T A 6: 107,569,120 H626Q probably benign Het
Mmp28 A T 11: 83,451,732 L40Q probably damaging Het
Mroh1 C T 15: 76,452,099 A1530V probably benign Het
Myo1e A G 9: 70,301,793 probably benign Het
Naa25 A T 5: 121,435,490 M761L probably benign Het
Ncln G A 10: 81,488,297 A465V probably damaging Het
Nktr A G 9: 121,731,484 N98S probably damaging Het
Olfr1012 T C 2: 85,759,904 I157M possibly damaging Het
Olfr215 C A 6: 116,582,781 S55I probably benign Het
Olfr651 T A 7: 104,553,369 V150E probably benign Het
Olfr76 G C 19: 12,120,370 A114G possibly damaging Het
Olfr878 G T 9: 37,919,553 A304S possibly damaging Het
Pacsin2 T C 15: 83,386,782 Y222C probably damaging Het
Pcdhb15 C T 18: 37,474,168 T151M possibly damaging Het
Plcz1 C A 6: 140,023,230 V161L possibly damaging Het
Ppp6c G A 2: 39,200,124 probably benign Het
Rhbdf2 T A 11: 116,603,992 Y286F probably benign Het
Rtn3 A T 19: 7,457,876 D231E probably damaging Het
Slc35c2 A C 2: 165,280,895 Y156* probably null Het
Spata46 A G 1: 170,311,537 D35G probably damaging Het
Tmed3 A G 9: 89,702,873 F110L possibly damaging Het
Tmem104 T G 11: 115,201,308 probably benign Het
Tpbg T A 9: 85,844,938 V320E possibly damaging Het
Trib2 T C 12: 15,793,663 D190G probably damaging Het
Tspan2 A G 3: 102,759,385 T26A probably damaging Het
Usp17lb A C 7: 104,841,151 Y190D possibly damaging Het
Utp18 C T 11: 93,880,147 probably benign Het
Utp20 A T 10: 88,820,979 D121E probably damaging Het
Vmn1r80 T A 7: 12,193,317 M118K possibly damaging Het
Vmn1r84 T C 7: 12,361,867 S300G probably benign Het
Other mutations in AI314180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:AI314180 APN 4 58828047 missense possibly damaging 0.95
IGL01145:AI314180 APN 4 58811501 missense probably null 0.08
IGL01371:AI314180 APN 4 58809718 missense probably damaging 1.00
IGL01445:AI314180 APN 4 58833988 missense probably benign 0.08
IGL01452:AI314180 APN 4 58836181 missense probably damaging 0.99
IGL01626:AI314180 APN 4 58832814 splice site probably benign
IGL01672:AI314180 APN 4 58814041 missense probably benign 0.40
IGL01943:AI314180 APN 4 58849937 missense possibly damaging 0.91
IGL01944:AI314180 APN 4 58861544 missense probably benign 0.42
IGL02190:AI314180 APN 4 58800190 missense probably benign 0.12
IGL02272:AI314180 APN 4 58811731 missense probably benign 0.00
IGL02435:AI314180 APN 4 58830325 splice site probably benign
IGL02516:AI314180 APN 4 58877102 missense probably damaging 1.00
IGL02540:AI314180 APN 4 58805534 splice site probably benign
IGL02709:AI314180 APN 4 58872699 missense possibly damaging 0.90
IGL02742:AI314180 APN 4 58840757 missense probably damaging 0.96
IGL02812:AI314180 APN 4 58864343 splice site probably benign
IGL02828:AI314180 APN 4 58875512 missense possibly damaging 0.59
IGL03130:AI314180 APN 4 58800288 missense probably benign
IGL03179:AI314180 APN 4 58832777 missense probably damaging 1.00
IGL03237:AI314180 APN 4 58810668 missense probably benign 0.40
IGL03344:AI314180 APN 4 58828538 missense probably damaging 1.00
BB006:AI314180 UTSW 4 58869554 missense probably damaging 1.00
BB016:AI314180 UTSW 4 58869554 missense probably damaging 1.00
R0051:AI314180 UTSW 4 58832729 missense probably damaging 1.00
R0051:AI314180 UTSW 4 58832729 missense probably damaging 1.00
R0313:AI314180 UTSW 4 58811892 missense probably benign 0.11
R0487:AI314180 UTSW 4 58819155 missense probably damaging 1.00
R0492:AI314180 UTSW 4 58864418 missense probably damaging 1.00
R0705:AI314180 UTSW 4 58885366 critical splice donor site probably null
R0847:AI314180 UTSW 4 58841439 missense probably benign 0.14
R1467:AI314180 UTSW 4 58832753 missense probably benign
R1467:AI314180 UTSW 4 58832753 missense probably benign
R1482:AI314180 UTSW 4 58820163 missense possibly damaging 0.85
R1529:AI314180 UTSW 4 58832701 splice site probably null
R1771:AI314180 UTSW 4 58879100 missense probably damaging 1.00
R1776:AI314180 UTSW 4 58879100 missense probably damaging 1.00
R1822:AI314180 UTSW 4 58805539 critical splice donor site probably null
R1864:AI314180 UTSW 4 58849942 missense possibly damaging 0.62
R2029:AI314180 UTSW 4 58844165 nonsense probably null
R2061:AI314180 UTSW 4 58824270 missense probably damaging 1.00
R2125:AI314180 UTSW 4 58833978 missense probably benign
R2266:AI314180 UTSW 4 58830332 critical splice donor site probably null
R2889:AI314180 UTSW 4 58836165 missense probably benign
R2902:AI314180 UTSW 4 58809691 missense probably benign 0.31
R2903:AI314180 UTSW 4 58828622 missense possibly damaging 0.50
R2925:AI314180 UTSW 4 58833928 nonsense probably null
R4151:AI314180 UTSW 4 58836254 missense possibly damaging 0.51
R4225:AI314180 UTSW 4 58847027 missense probably damaging 1.00
R4486:AI314180 UTSW 4 58820086 intron probably benign
R4576:AI314180 UTSW 4 58834708 intron probably benign
R4580:AI314180 UTSW 4 58840751 missense probably damaging 1.00
R4654:AI314180 UTSW 4 58834523 missense possibly damaging 0.86
R4688:AI314180 UTSW 4 58840757 missense probably damaging 0.96
R4726:AI314180 UTSW 4 58844191 missense probably damaging 1.00
R4825:AI314180 UTSW 4 58850911 missense probably damaging 0.99
R4928:AI314180 UTSW 4 58827073 missense probably damaging 1.00
R5098:AI314180 UTSW 4 58877048 missense probably damaging 1.00
R5284:AI314180 UTSW 4 58836172 missense possibly damaging 0.90
R5375:AI314180 UTSW 4 58809401 nonsense probably null
R5382:AI314180 UTSW 4 58850934 missense probably benign 0.38
R5487:AI314180 UTSW 4 58809421 missense probably benign 0.22
R5703:AI314180 UTSW 4 58877171 splice site probably null
R5761:AI314180 UTSW 4 58853131 missense probably damaging 1.00
R5791:AI314180 UTSW 4 58814027 missense possibly damaging 0.90
R5791:AI314180 UTSW 4 58822111 missense probably damaging 1.00
R5928:AI314180 UTSW 4 58849948 missense possibly damaging 0.59
R6062:AI314180 UTSW 4 58826453 missense possibly damaging 0.84
R6246:AI314180 UTSW 4 58811365 splice site probably null
R6298:AI314180 UTSW 4 58877157 missense probably damaging 1.00
R6326:AI314180 UTSW 4 58827068 missense probably benign 0.34
R6478:AI314180 UTSW 4 58810785 missense probably damaging 1.00
R6707:AI314180 UTSW 4 58879101 missense possibly damaging 0.52
R6846:AI314180 UTSW 4 58814081 missense possibly damaging 0.85
R6857:AI314180 UTSW 4 58814065 missense probably damaging 1.00
R6951:AI314180 UTSW 4 58853114 critical splice donor site probably null
R7088:AI314180 UTSW 4 58849766 missense possibly damaging 0.93
R7302:AI314180 UTSW 4 58834593 missense probably benign 0.43
R7337:AI314180 UTSW 4 58827047 missense possibly damaging 0.69
R7341:AI314180 UTSW 4 58809415 missense possibly damaging 0.94
R7344:AI314180 UTSW 4 58824770 missense probably benign 0.08
R7525:AI314180 UTSW 4 58847038 missense possibly damaging 0.84
R7530:AI314180 UTSW 4 58815317 missense probably damaging 0.99
R7533:AI314180 UTSW 4 58809411 missense probably benign 0.12
R7557:AI314180 UTSW 4 58849691 missense possibly damaging 0.85
R7698:AI314180 UTSW 4 58832660 missense unknown
R7793:AI314180 UTSW 4 58853150 missense probably damaging 1.00
R7892:AI314180 UTSW 4 58828593 missense probably benign
R7894:AI314180 UTSW 4 58853708 missense probably damaging 1.00
R7929:AI314180 UTSW 4 58869554 missense probably damaging 1.00
R8010:AI314180 UTSW 4 58832681 missense unknown
R8082:AI314180 UTSW 4 58807852 missense probably benign 0.00
R8175:AI314180 UTSW 4 58872756 missense probably damaging 1.00
R8191:AI314180 UTSW 4 58872587 critical splice donor site probably null
R8326:AI314180 UTSW 4 58847093 missense probably damaging 1.00
X0060:AI314180 UTSW 4 58840752 missense possibly damaging 0.73
Z1177:AI314180 UTSW 4 58861614 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAACCAATCTCCTTCCGTGTACTCATC -3'
(R):5'- ACTAGCcacaagcctttaacccca -3'

Sequencing Primer
(F):5'- TCCGTGTACTCATCAACATTAGAC -3'
(R):5'- GAACACATGGACTAGTATTGCCTC -3'
Posted On2013-05-23