Mutagenetix > Incidental Mutations

Incidental Mutation 'R4936:Zfp407'

380420

Institutional Source

Beutler Lab

Gene Symbol

Zfp407

Ensembl Gene

ENSMUSG00000048410

Gene Name

zinc finger protein 407

Synonyms

6430585N13Rik, LOC240469, LOC381139

MMRRC Submission

042536-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4936 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84128027-84589725 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84559464 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1175 (I1175V)

Ref Sequence

ENSEMBL: ENSMUSP00000118361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000125763]

AlphaFold

G3UVV3

Predicted Effect

probably benign
Transcript: ENSMUST00000125450

Predicted Effect

probably benign
Transcript: ENSMUST00000125763
AA Change: I1175V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000118361
Gene: ENSMUSG00000048410
AA Change: I1175V

Domain	Start	End	E-Value	Type
low complexity region	20	37	N/A	INTRINSIC
ZnF_C2H2	178	200	8.67e-1	SMART
ZnF_U1	233	267	6.79e-1	SMART
ZnF_C2H2	236	260	4.65e-1	SMART
ZnF_C2H2	522	545	7.05e-1	SMART
ZnF_U1	548	582	1.54e1	SMART
ZnF_C2H2	551	575	1.01e-1	SMART
ZnF_C2H2	582	605	1.41e0	SMART
ZnF_U1	606	639	2.22e0	SMART
ZnF_C2H2	609	632	1.01e2	SMART
ZnF_C2H2	695	718	6.23e-2	SMART
ZnF_U1	721	755	2.96e0	SMART
ZnF_C2H2	724	748	7.11e0	SMART
ZnF_C2H2	840	863	7.55e-1	SMART
ZnF_U1	866	900	3.81e-1	SMART
ZnF_C2H2	869	893	1.07e0	SMART
ZnF_C2H2	1009	1032	6.13e-1	SMART
ZnF_U1	1035	1069	2.22e0	SMART
ZnF_C2H2	1038	1062	5.62e0	SMART
low complexity region	1223	1234	N/A	INTRINSIC
ZnF_C2H2	1405	1428	5.92e0	SMART
ZnF_U1	1432	1466	2.35e0	SMART
ZnF_C2H2	1435	1459	1.76e-1	SMART
ZnF_C2H2	1477	1500	5.42e-2	SMART
ZnF_C2H2	1528	1552	1.68e1	SMART
ZnF_C2H2	1558	1580	1.43e-1	SMART
ZnF_C2H2	1586	1609	9.58e-3	SMART
ZnF_C2H2	1619	1641	2.61e-4	SMART
ZnF_C2H2	1647	1671	1.04e-3	SMART
ZnF_C2H2	1677	1699	9.44e-2	SMART
ZnF_C2H2	1705	1727	1.82e-3	SMART
ZnF_C2H2	1733	1758	4.65e-1	SMART
ZnF_C2H2	1764	1787	1.26e-2	SMART
low complexity region	1876	1887	N/A	INTRINSIC
low complexity region	2017	2032	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156181

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182297

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.0%
20x: 87.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein whose exact function is not known. It may be involved in transcriptional regulation. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300002M23Rik	T	A	17: 35,568,315	F183L	possibly damaging	Het
4930590J08Rik	T	A	6: 91,944,264	M775K	probably damaging	Het
Actn1	T	G	12: 80,172,998	I700L	probably benign	Het
Adam5	T	C	8: 24,786,271	Y460C	probably damaging	Het
Akna	C	T	4: 63,395,265	G207E	probably damaging	Het
Ank2	T	A	3: 126,955,039	H527L	possibly damaging	Het
Anks1	C	A	17: 27,988,805	N383K	probably damaging	Het
Apba3	C	T	10: 81,269,370		probably null	Het
Atp9b	C	A	18: 80,736,093	V1121F	possibly damaging	Het
Bsn	T	C	9: 108,111,761	Y2264C	probably damaging	Het
Bst1	A	G	5: 43,840,457	D266G	probably damaging	Het
Cep55	A	G	19: 38,071,754		probably null	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Ckb	T	C	12: 111,671,230	K156E	probably benign	Het
Cln3	T	A	7: 126,575,221	H315L	probably damaging	Het
Cnot6l	A	G	5: 96,079,937	F479S	probably damaging	Het
Col1a1	A	G	11: 94,947,132	D826G	unknown	Het
Cyp27a1	T	C	1: 74,735,405	V194A	probably benign	Het
Dis3l2	C	T	1: 87,044,168	P643S	probably benign	Het
Dpf3	T	C	12: 83,331,966	D108G	probably damaging	Het
Eif2b4	C	T	5: 31,192,897	G27D	probably benign	Het
Eif4a1	T	G	11: 69,672,425		probably benign	Het
Espl1	A	T	15: 102,304,937	D566V	probably damaging	Het
Ext2	T	A	2: 93,813,679	R86*	probably null	Het
Fasn	A	T	11: 120,816,085	F914I	probably damaging	Het
Fbf1	A	G	11: 116,152,552	L477P	probably benign	Het
Fsd1	A	T	17: 55,996,452	K441N	possibly damaging	Het
Fsip2	T	A	2: 82,985,040	S3706T	probably benign	Het
Gabra5	A	T	7: 57,408,799	N400K	probably benign	Het
Gimap8	G	T	6: 48,656,134	G296W	probably damaging	Het
Gli2	A	G	1: 118,836,140	V1427A	probably benign	Het
Gm7334	A	T	17: 50,698,827	Y47F	probably damaging	Het
Gm8674	T	G	13: 49,900,755		noncoding transcript	Het
Gmeb2	G	T	2: 181,254,246	T377K	probably benign	Het
Gp9	T	A	6: 87,779,247	D81E	probably benign	Het
Il5ra	T	A	6: 106,738,162	I212F	possibly damaging	Het
Klhl18	G	T	9: 110,428,961	N470K	possibly damaging	Het
Lfng	G	T	5: 140,612,395		probably null	Het
Lpo	A	G	11: 87,810,340	I430T	probably benign	Het
Lrrc31	C	T	3: 30,689,268	D183N	probably damaging	Het
Meis2	T	C	2: 115,864,412	T410A	probably benign	Het
Myo6	A	G	9: 80,307,681	D1232G	probably damaging	Het
Ncapd2	C	T	6: 125,169,840	R1261H	probably benign	Het
Nfkb1	C	T	3: 135,613,982	V251M	probably damaging	Het
Nmbr	C	A	10: 14,766,986	H96Q	probably damaging	Het
Nop14	C	T	5: 34,652,393	R256H	probably damaging	Het
Nqo2	T	A	13: 33,981,518	Y133N	probably damaging	Het
Olfr1153	A	G	2: 87,896,813	I213V	probably benign	Het
Olfr1366	T	C	13: 21,537,187	I273V	probably benign	Het
Pbld2	C	A	10: 63,052,238	S168R	probably damaging	Het
Pcdhb7	G	T	18: 37,342,149	G113*	probably null	Het
Pcdhb7	G	T	18: 37,342,150	G113V	probably damaging	Het
Pdgfra	A	T	5: 75,195,026	T1066S	probably damaging	Het
Prdm8	A	T	5: 98,185,022		probably null	Het
Prdm8	G	T	5: 98,185,023		probably null	Het
Prkg1	T	C	19: 30,586,375	Y479C	probably benign	Het
Pudp	T	C	18: 50,568,468	T65A	probably benign	Het
Rbbp6	C	T	7: 122,999,703		probably benign	Het
Rcc1	C	G	4: 132,335,735	V187L	probably damaging	Het
Rims2	T	A	15: 39,437,728	M285K	probably damaging	Het
Rtkn2	T	C	10: 68,041,915	*602Q	probably null	Het
Rxfp3	T	G	15: 11,036,780	S169R	probably damaging	Het
Sardh	T	C	2: 27,228,241		probably null	Het
Slc24a2	A	T	4: 87,227,347	F157I	probably damaging	Het
Slc25a20	T	C	9: 108,681,992	Y186H	probably damaging	Het
Slc25a24	A	G	3: 109,163,548	R408G	probably damaging	Het
Slc44a5	T	G	3: 154,253,716	I348S	probably damaging	Het
Slc8a2	A	T	7: 16,134,175	K111*	probably null	Het
Smc5	A	G	19: 23,234,003	V589A	probably damaging	Het
Thbd	A	T	2: 148,407,735	I71N	probably damaging	Het
Thsd7b	T	C	1: 129,678,145	M541T	probably benign	Het
Tie1	T	A	4: 118,484,771		silent	Het
Tln1	A	G	4: 43,547,522	F813S	possibly damaging	Het
Tnrc18	A	T	5: 142,765,977	L1191*	probably null	Het
Tubb2a	A	C	13: 34,075,257	Y183*	probably null	Het
Ubr4	T	A	4: 139,396,566	V343E	probably damaging	Het
Vmn2r93	A	T	17: 18,304,065	D107V	possibly damaging	Het
Vwa5a	T	G	9: 38,736,198	S624R	probably benign	Het
Wwox	G	A	8: 114,706,358	V255I	probably benign	Het
Wwp1	T	C	4: 19,638,804	K546E	probably damaging	Het
Xirp2	T	A	2: 67,509,819	F801L	possibly damaging	Het
Zfp646	T	A	7: 127,881,761	C1037S	possibly damaging	Het
Zfp786	A	T	6: 47,821,268	C245*	probably null	Het
Zfp827	T	C	8: 79,061,183	V326A	probably benign	Het

Other mutations in Zfp407

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Zfp407	APN	18	84561752	missense	probably damaging	0.99
IGL02105:Zfp407	APN	18	84562720	nonsense	probably null
IGL02110:Zfp407	APN	18	84559040	missense	probably benign	0.00
IGL02343:Zfp407	APN	18	84209724	missense	possibly damaging	0.71
IGL02456:Zfp407	APN	18	84558641	missense	probably damaging	1.00
IGL02705:Zfp407	APN	18	84559031	nonsense	probably null
IGL02946:Zfp407	APN	18	84560709	missense	probably damaging	1.00
IGL03069:Zfp407	APN	18	84350975	missense	probably damaging	1.00
IGL03145:Zfp407	APN	18	84209721	missense	probably damaging	0.99
IGL03403:Zfp407	APN	18	84560797	missense	probably damaging	1.00
IGL03134:Zfp407	UTSW	18	84209955	missense	probably damaging	0.99
PIT4362001:Zfp407	UTSW	18	84561268	missense	possibly damaging	0.87
PIT4520001:Zfp407	UTSW	18	84432420	missense	probably damaging	0.99
R0087:Zfp407	UTSW	18	84560411	missense	probably damaging	1.00
R0243:Zfp407	UTSW	18	84558711	missense	probably damaging	1.00
R0594:Zfp407	UTSW	18	84562567	missense	possibly damaging	0.87
R0766:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R0787:Zfp407	UTSW	18	84209022	missense	probably damaging	1.00
R0787:Zfp407	UTSW	18	84209346	missense	probably benign	0.00
R1065:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1086:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1165:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1186:Zfp407	UTSW	18	84209448	missense	probably benign	0.39
R1203:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1312:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1345:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1385:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1421:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1430:Zfp407	UTSW	18	84209455	missense	probably benign	0.18
R1436:Zfp407	UTSW	18	84343071	splice site	probably benign
R1498:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1526:Zfp407	UTSW	18	84561033	missense	possibly damaging	0.61
R1579:Zfp407	UTSW	18	84209638	missense	probably benign	0.00
R1594:Zfp407	UTSW	18	84209331	missense	probably benign	0.01
R1628:Zfp407	UTSW	18	84354533	missense	probably damaging	1.00
R1698:Zfp407	UTSW	18	84562157	missense	probably damaging	1.00
R1962:Zfp407	UTSW	18	84559336	missense	probably benign	0.01
R1984:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1985:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1986:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R2151:Zfp407	UTSW	18	84209649	missense	possibly damaging	0.55
R2152:Zfp407	UTSW	18	84209649	missense	possibly damaging	0.55
R2154:Zfp407	UTSW	18	84209649	missense	possibly damaging	0.55
R2259:Zfp407	UTSW	18	84209793	missense	probably damaging	1.00
R2353:Zfp407	UTSW	18	84559880	missense	probably damaging	1.00
R2845:Zfp407	UTSW	18	84558397	nonsense	probably null
R3407:Zfp407	UTSW	18	84558872	missense	probably benign	0.08
R3432:Zfp407	UTSW	18	84208746	missense	probably damaging	1.00
R3892:Zfp407	UTSW	18	84560352	missense	probably damaging	1.00
R4026:Zfp407	UTSW	18	84559596	missense	possibly damaging	0.82
R4107:Zfp407	UTSW	18	84343007	missense	possibly damaging	0.82
R4398:Zfp407	UTSW	18	84562731	nonsense	probably null
R4447:Zfp407	UTSW	18	84562694	missense	possibly damaging	0.95
R4752:Zfp407	UTSW	18	84562914	missense	probably benign	0.01
R4881:Zfp407	UTSW	18	84559703	missense	probably benign	0.27
R5194:Zfp407	UTSW	18	84561309	missense	probably benign	0.05
R5243:Zfp407	UTSW	18	84561091	missense	probably damaging	1.00
R5258:Zfp407	UTSW	18	84315926	missense	probably damaging	1.00
R5591:Zfp407	UTSW	18	84561137	missense	probably damaging	1.00
R5633:Zfp407	UTSW	18	84561044	missense	probably benign	0.35
R5739:Zfp407	UTSW	18	84208742	makesense	probably null
R5806:Zfp407	UTSW	18	84558614	missense	probably damaging	1.00
R5820:Zfp407	UTSW	18	84560524	missense	probably benign	0.01
R6187:Zfp407	UTSW	18	84559009	missense	possibly damaging	0.87
R6512:Zfp407	UTSW	18	84560349	missense	probably damaging	1.00
R6521:Zfp407	UTSW	18	84432411	missense	probably damaging	1.00
R6748:Zfp407	UTSW	18	84208830	missense	probably damaging	0.98
R6882:Zfp407	UTSW	18	84343069	splice site	probably null
R6899:Zfp407	UTSW	18	84561434	missense	possibly damaging	0.86
R7038:Zfp407	UTSW	18	84561857	missense	probably damaging	1.00
R7076:Zfp407	UTSW	18	84558476	missense	probably damaging	1.00
R7326:Zfp407	UTSW	18	84559042	missense	possibly damaging	0.77
R7397:Zfp407	UTSW	18	84561819	missense	possibly damaging	0.59
R7402:Zfp407	UTSW	18	84561536	missense	probably benign	0.02
R7783:Zfp407	UTSW	18	84209922	missense	possibly damaging	0.69
R7800:Zfp407	UTSW	18	84560675	missense	probably damaging	0.99
R7904:Zfp407	UTSW	18	84561256	missense	not run
R7942:Zfp407	UTSW	18	84559629	missense	probably benign	0.02
R7955:Zfp407	UTSW	18	84559291	missense	probably benign	0.02
R7988:Zfp407	UTSW	18	84559400	missense	possibly damaging	0.60
R8125:Zfp407	UTSW	18	84561185	missense	probably damaging	1.00
R8237:Zfp407	UTSW	18	84560144	missense	possibly damaging	0.87
R8364:Zfp407	UTSW	18	84552868	critical splice donor site	probably null
R8443:Zfp407	UTSW	18	84209862	missense	probably damaging	1.00
R8487:Zfp407	UTSW	18	84562770	nonsense	probably null
R8497:Zfp407	UTSW	18	84559896	missense	probably damaging	0.98
R8808:Zfp407	UTSW	18	84343060	missense	probably benign	0.17
R8848:Zfp407	UTSW	18	84560694	missense	probably damaging	1.00
R8913:Zfp407	UTSW	18	84560528	missense	probably damaging	0.99
R8962:Zfp407	UTSW	18	84558932	missense	probably damaging	1.00
R9087:Zfp407	UTSW	18	84209857	missense	probably damaging	0.96
RF003:Zfp407	UTSW	18	84209563	missense	probably benign	0.17
Z1177:Zfp407	UTSW	18	84209954	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- AGTAGATTCGGCAGAATGGC -3'
(R):5'- CTCTCCAATGTAGAAATCCTGCAG -3'

Sequencing Primer
(F):5'- AGAATGGCCCCCATCTGG -3'
(R):5'- CAATGTAGAAATCCTGCAGATTGTTC -3'

Posted On

2016-04-15