Mutagenetix > Incidental Mutations

Incidental Mutation 'R4937:Ptprc'

380429

Institutional Source

Beutler Lab

Gene Symbol

Ptprc

Ensembl Gene

ENSMUSG00000026395

Gene Name

protein tyrosine phosphatase, receptor type, C

Synonyms

B220, Ly-5, Lyt-4, CD45, T200

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.334) question?

Stock #

R4937 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

138062861-138175708 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 138089500 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 483 (F483L)

Ref Sequence

ENSEMBL: ENSMUSP00000138275 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000182283] [ENSMUST00000182755] [ENSMUST00000183301]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000112036

SMART Domains

Protein: ENSMUSP00000107667
Gene: ENSMUSG00000026395

Domain	Start	End	E-Value	Type
Pfam:PTP_N	5	30	5.8e-13	PFAM
low complexity region	31	64	N/A	INTRINSIC
Pfam:CD45	70	129	1.8e-24	PFAM
FN3	233	317	2.28e0	SMART
FN3	333	411	3.48e-1	SMART
transmembrane domain	426	447	N/A	INTRINSIC
PTPc	500	762	7.57e-127	SMART
PTPc	791	1077	1.39e-102	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000182283
AA Change: F507L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138800
Gene: ENSMUSG00000026395
AA Change: F507L

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	32	4.2e-13	PFAM
low complexity region	33	66	N/A	INTRINSIC
Pfam:CD45	72	131	2.3e-24	PFAM
FN3	235	319	2.28e0	SMART
FN3	335	413	3.48e-1	SMART
transmembrane domain	428	449	N/A	INTRINSIC
PTPc	502	764	7.57e-127	SMART
PTPc	793	1079	1.39e-102	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000182755
AA Change: F483L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138275
Gene: ENSMUSG00000026395
AA Change: F483L

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	34	5.5e-13	PFAM
Pfam:CD45	48	107	2.3e-24	PFAM
FN3	211	295	2.28e0	SMART
FN3	311	389	3.48e-1	SMART
transmembrane domain	404	425	N/A	INTRINSIC
PTPc	478	740	7.57e-127	SMART
PTPc	769	1055	1.39e-102	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000183301
AA Change: F646L

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000138350
Gene: ENSMUSG00000026395
AA Change: F646L

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	33	2.7e-13	PFAM
low complexity region	111	128	N/A	INTRINSIC
low complexity region	170	205	N/A	INTRINSIC
Pfam:CD45	211	270	2.1e-24	PFAM
FN3	374	458	2.28e0	SMART
FN3	474	552	3.48e-1	SMART
transmembrane domain	567	588	N/A	INTRINSIC
PTPc	641	903	7.57e-127	SMART
PTPc	932	1218	1.39e-102	SMART

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.1%
20x: 88.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mutants have defective T cell, B cell, and NK cell morphology and physiology. Mice carrying an engineered point mutation exhibit lymphoproliferation and autoimmunity that leads to premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	G	5: 109,736,201	F597S	probably benign	Het
4933406M09Rik	T	A	1: 134,389,976	M162K	probably benign	Het
Aasdh	C	A	5: 76,888,654	E347*	probably null	Het
Abca16	G	T	7: 120,527,086	C1155F	probably damaging	Het
Adam26a	T	C	8: 43,568,881	D524G	probably damaging	Het
Adamts20	G	C	15: 94,379,775	H269D	probably benign	Het
Akap9	T	A	5: 4,050,145		probably null	Het
Akt3	T	C	1: 177,050,127	I358M	possibly damaging	Het
Aldh9a1	G	T	1: 167,361,807	A375S	probably damaging	Het
Alg2	A	G	4: 47,473,974	S105P	probably benign	Het
Amph	A	G	13: 19,104,345	T335A	probably damaging	Het
Ank2	C	T	3: 126,962,401	V1056M	probably damaging	Het
Apoh	A	G	11: 108,407,378	D168G	probably benign	Het
Arfgef3	C	T	10: 18,589,706	A2130T	probably damaging	Het
Arhgap30	A	G	1: 171,403,329	D218G	probably benign	Het
Ascc3	C	T	10: 50,823,798	P1906S	probably damaging	Het
Atp11b	T	G	3: 35,807,008		probably null	Het
B4galnt2	A	G	11: 95,868,429	V343A	probably damaging	Het
Barhl1	T	C	2: 28,909,773	Y280C	probably damaging	Het
Bcar1	A	T	8: 111,721,037	Y103N	probably damaging	Het
Bid	A	G	6: 120,895,746	I150T	probably benign	Het
Ccdc171	T	C	4: 83,549,639	S74P	probably damaging	Het
Ccni	A	T	5: 93,188,254		probably null	Het
Cct8l1	A	G	5: 25,516,893	E202G	probably benign	Het
Cd200r3	A	G	16: 44,954,259	K212E	probably benign	Het
Cdh19	A	G	1: 110,889,964	S683P	probably damaging	Het
Ces2b	A	T	8: 104,832,781	H93L	probably benign	Het
Clec4a1	G	A	6: 122,930,695	C114Y	probably damaging	Het
Dcc	G	T	18: 71,542,249	S636*	probably null	Het
Dcdc2c	T	C	12: 28,530,473	D187G	possibly damaging	Het
Dgkb	G	T	12: 38,114,658	E150*	probably null	Het
Dhx30	A	G	9: 110,085,961	L884P	probably damaging	Het
Dmwd	T	G	7: 19,081,303		probably null	Het
Dnah17	T	A	11: 118,042,154	N3593Y	probably damaging	Het
Dnm2	G	A	9: 21,481,337	S447N	probably benign	Het
Elk4	G	A	1: 132,017,681	G99D	probably damaging	Het
Entpd1	A	T	19: 40,739,521		probably benign	Het
Fam114a1	T	A	5: 64,979,727	D4E	probably damaging	Het
Fam160b1	T	C	19: 57,378,637	V204A	probably benign	Het
Fam166b	T	A	4: 43,427,514	Q270L	possibly damaging	Het
Fbln2	A	G	6: 91,264,699	D754G	probably damaging	Het
Foxred2	T	C	15: 77,955,835	N85S	probably damaging	Het
Fut9	A	G	4: 25,799,591		probably benign	Het
Gm13023	T	C	4: 143,793,837	V53A	possibly damaging	Het
Gm13762	T	A	2: 88,973,490	I134F	probably damaging	Het
Gm14124	C	T	2: 150,268,760	H457Y	unknown	Het
Gm1818	G	A	12: 48,559,824		noncoding transcript	Het
Gm4894	C	A	9: 49,278,700	Q92K	unknown	Het
Gpx2	T	C	12: 76,792,800	I141M	probably benign	Het
Gusb	T	C	5: 129,995,485	T476A	probably damaging	Het
Hmmr	G	A	11: 40,721,840	T180I	possibly damaging	Het
Itgbl1	T	C	14: 123,973,368	Y493H	probably benign	Het
Klhdc9	G	T	1: 171,360,383	C93*	probably null	Het
Lpar3	A	G	3: 146,284,751	K275E	probably damaging	Het
Lrp1b	A	G	2: 40,802,885		probably null	Het
Lrrc63	C	T	14: 75,084,949	G572S	probably damaging	Het
Mapk11	A	T	15: 89,146,482	D98E	probably benign	Het
Net1	G	A	13: 3,884,905	R374W	probably damaging	Het
Nlrp4g	T	A	9: 124,354,005		noncoding transcript	Het
Nrap	T	A	19: 56,347,220	Y923F	probably damaging	Het
Olfr53	T	A	7: 140,652,621	M214K	probably benign	Het
Olfr811	A	T	10: 129,802,063	V154E	probably benign	Het
Plxnc1	A	G	10: 94,841,473	V964A	probably damaging	Het
Pmfbp1	A	G	8: 109,535,866	I731V	probably benign	Het
Polq	T	A	16: 37,027,912	S294T	probably benign	Het
Pomgnt2	T	C	9: 121,982,554	D387G	probably benign	Het
Prmt2	G	A	10: 76,221,008	T227I	probably damaging	Het
Psmd1	T	A	1: 86,083,225	F341I	probably damaging	Het
Ptpn23	T	C	9: 110,392,738	M127V	probably benign	Het
Rab35	A	C	5: 115,640,088	I38L	probably damaging	Het
Rapgef6	A	G	11: 54,657,317	T486A	probably damaging	Het
Rgl3	A	T	9: 21,987,708	C68*	probably null	Het
Rilpl1	T	C	5: 124,515,531	E189G	possibly damaging	Het
Rnf217	T	C	10: 31,517,524	I354V	probably benign	Het
Rspo3	T	C	10: 29,506,528	D50G	probably damaging	Het
Sbno1	A	G	5: 124,374,609	S1366P	possibly damaging	Het
Sema3c	A	G	5: 17,694,686	D392G	probably benign	Het
Serpinb9e	A	T	13: 33,252,952	Y85F	probably benign	Het
Shprh	C	T	10: 11,157,119	T283I	probably benign	Het
Sipa1l1	T	C	12: 82,341,329	S110P	probably benign	Het
Slc16a12	T	A	19: 34,675,243	I168F	probably damaging	Het
Slc23a3	A	G	1: 75,132,624	S221P	probably damaging	Het
Slc35b3	A	T	13: 38,932,911	I366K	possibly damaging	Het
Slc44a5	T	C	3: 154,243,615		probably null	Het
Slc5a12	A	T	2: 110,620,408	D316V	probably damaging	Het
Ssr3	A	G	3: 65,392,453	S29P	probably damaging	Het
Taf2	G	A	15: 55,027,223	Q1055*	probably null	Het
Them6	A	T	15: 74,721,518	D75V	probably damaging	Het
Tmem159	T	C	7: 120,116,312	S120P	probably damaging	Het
Tom1l2	A	G	11: 60,258,918	S239P	probably damaging	Het
Tspear	A	G	10: 77,875,043	T500A	probably damaging	Het
Tubgcp6	G	A	15: 89,101,549	A1487V	probably damaging	Het
Uba7	G	A	9: 107,978,991	V522I	possibly damaging	Het
Virma	C	A	4: 11,521,147	C901*	probably null	Het
Vmn1r172	A	T	7: 23,659,887	I66F	possibly damaging	Het
Vmn2r82	A	T	10: 79,379,176	Y331F	probably benign	Het
Wdr55	G	A	18: 36,762,398	V143I	probably benign	Het
Zbtb49	A	T	5: 38,213,963	D191E	possibly damaging	Het
Zfhx4	A	G	3: 5,242,011	H99R	probably damaging	Het
Zfp560	C	T	9: 20,347,967	C533Y	probably damaging	Het
Zfp646	C	T	7: 127,879,182	A177V	probably benign	Het
Zfp653	C	T	9: 22,055,778	E604K	probably damaging	Het

Other mutations in Ptprc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
lochy	APN	1	138083790	splice site	probably benign
IGL00486:Ptprc	APN	1	138115621	missense	probably damaging	0.97
IGL00771:Ptprc	APN	1	138113677	missense	probably benign	0.00
IGL00833:Ptprc	APN	1	138078492	missense	possibly damaging	0.55
IGL00919:Ptprc	APN	1	138113642	missense	probably damaging	1.00
IGL01020:Ptprc	APN	1	138120173	critical splice acceptor site	probably null	0.00
IGL01024:Ptprc	APN	1	138080912	missense	probably damaging	1.00
IGL01302:Ptprc	APN	1	138099631	missense	possibly damaging	0.82
IGL01548:Ptprc	APN	1	138099481	critical splice donor site	probably null	0.00
IGL01620:Ptprc	APN	1	138068410	missense	possibly damaging	0.88
IGL01775:Ptprc	APN	1	138064759	missense	probably damaging	1.00
IGL01820:Ptprc	APN	1	138066198	missense	probably damaging	1.00
IGL02340:Ptprc	APN	1	138071219	missense	probably damaging	1.00
IGL02943:Ptprc	APN	1	138099513	missense	probably damaging	0.99
IGL03169:Ptprc	APN	1	138113619	missense	probably benign	0.15
IGL03308:Ptprc	APN	1	138126320	missense	possibly damaging	0.70
IGL03404:Ptprc	APN	1	138093001	missense	probably damaging	1.00
belittle	UTSW	1	138137493	intron	probably benign
bletchley	UTSW	1	138117862	missense	probably benign
Blush	UTSW	1	138117720	intron	probably benign
chor_muang	UTSW	1	138113562	critical splice donor site	probably null
crystal	UTSW	1	138072255	critical splice donor site	probably null
Dumpling	UTSW	1	138067890	missense	probably damaging	1.00
fuchsia	UTSW	1	138101041	critical splice donor site	probably null
Gentian	UTSW	1	138067885	critical splice donor site	probably null
guotie	UTSW	1	138068401	nonsense	probably null
guotie2	UTSW	1	138094299	missense	probably damaging	0.97
Guotie3	UTSW	1	138078451	missense	possibly damaging	0.92
Gyoza	UTSW	1	138083567	missense	probably damaging	1.00
Half_measure	UTSW	1	138071249	missense	probably damaging	0.98
jirisan	UTSW	1	138113678	nonsense	probably null
mauve	UTSW	1	138099685	missense	probably benign
Perverse	UTSW	1	138101044	missense	probably benign	0.02
ultra	UTSW	1	138078445	critical splice donor site	probably null
violaceous	UTSW	1	138083639	missense	possibly damaging	0.77
R0013:Ptprc	UTSW	1	138113559	unclassified	probably null
R0189:Ptprc	UTSW	1	138082715	missense	probably benign	0.10
R0390:Ptprc	UTSW	1	138122575	missense	possibly damaging	0.71
R0504:Ptprc	UTSW	1	138088697	missense	probably damaging	1.00
R0602:Ptprc	UTSW	1	138089485	splice site	probably benign
R0627:Ptprc	UTSW	1	138068320	missense	probably damaging	0.99
R0632:Ptprc	UTSW	1	138073610	missense	probably benign	0.01
R0751:Ptprc	UTSW	1	138092930	missense	probably damaging	1.00
R0839:Ptprc	UTSW	1	138101132	missense	possibly damaging	0.47
R0942:Ptprc	UTSW	1	138068401	nonsense	probably null
R0943:Ptprc	UTSW	1	138111164	missense	probably damaging	0.96
R1159:Ptprc	UTSW	1	138072319	missense	probably damaging	1.00
R1442:Ptprc	UTSW	1	138072312	missense	probably damaging	1.00
R1489:Ptprc	UTSW	1	138120086	missense	possibly damaging	0.91
R1728:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1728:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1728:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1728:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1728:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1729:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1729:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1729:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1729:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1729:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1730:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1730:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1730:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1730:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1730:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1739:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1739:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1739:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1739:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1739:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1762:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1762:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1762:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1762:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1762:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1783:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1783:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1783:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1783:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1783:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1784:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1784:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1784:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1784:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1784:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1785:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1785:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1785:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1785:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1785:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1862:Ptprc	UTSW	1	138112227	missense	probably benign	0.13
R2145:Ptprc	UTSW	1	138073681	missense	probably damaging	1.00
R2290:Ptprc	UTSW	1	138111188	missense	probably benign	0.00
R2403:Ptprc	UTSW	1	138088532	missense	probably damaging	1.00
R2439:Ptprc	UTSW	1	138066152	missense	possibly damaging	0.67
R2887:Ptprc	UTSW	1	138080178	missense	probably damaging	1.00
R2906:Ptprc	UTSW	1	138064534	missense	possibly damaging	0.93
R3774:Ptprc	UTSW	1	138064773	missense	probably damaging	0.97
R3775:Ptprc	UTSW	1	138064773	missense	probably damaging	0.97
R3776:Ptprc	UTSW	1	138064773	missense	probably damaging	0.97
R3834:Ptprc	UTSW	1	138083567	missense	probably damaging	1.00
R4019:Ptprc	UTSW	1	138078516	missense	probably damaging	1.00
R4377:Ptprc	UTSW	1	138067925	missense	probably benign	0.04
R4580:Ptprc	UTSW	1	138071251	missense	probably benign	0.09
R4923:Ptprc	UTSW	1	138078498	missense	possibly damaging	0.93
R4925:Ptprc	UTSW	1	138099497	missense	probably benign	0.04
R4970:Ptprc	UTSW	1	138094299	missense	probably damaging	0.97
R5112:Ptprc	UTSW	1	138094299	missense	probably damaging	0.97
R5145:Ptprc	UTSW	1	138089566	missense	probably benign	0.07
R5158:Ptprc	UTSW	1	138175084	missense	possibly damaging	0.75
R5223:Ptprc	UTSW	1	138117862	missense	probably benign
R5593:Ptprc	UTSW	1	138117720	intron	probably benign
R5689:Ptprc	UTSW	1	138117777	missense	probably benign	0.01
R5885:Ptprc	UTSW	1	138088508	missense	probably damaging	1.00
R6010:Ptprc	UTSW	1	138101056	missense	probably benign	0.09
R6026:Ptprc	UTSW	1	138071249	missense	probably damaging	0.98
R6047:Ptprc	UTSW	1	138101041	critical splice donor site	probably null
R6173:Ptprc	UTSW	1	138067890	missense	probably damaging	1.00
R6328:Ptprc	UTSW	1	138113678	nonsense	probably null
R6383:Ptprc	UTSW	1	138078451	missense	possibly damaging	0.92
R6436:Ptprc	UTSW	1	138083639	missense	possibly damaging	0.77
R6492:Ptprc	UTSW	1	138113562	critical splice donor site	probably null
R6520:Ptprc	UTSW	1	138080143	nonsense	probably null
R6805:Ptprc	UTSW	1	138067885	critical splice donor site	probably null
R6830:Ptprc	UTSW	1	138072255	critical splice donor site	probably null
R6847:Ptprc	UTSW	1	138088545	missense	probably damaging	0.99
R6960:Ptprc	UTSW	1	138078445	critical splice donor site	probably null
R6995:Ptprc	UTSW	1	138088744	missense	probably damaging	1.00
R7009:Ptprc	UTSW	1	138064553	missense	probably damaging	0.97
R7041:Ptprc	UTSW	1	138126309	missense	probably benign	0.04
R7055:Ptprc	UTSW	1	138089571	missense	probably damaging	1.00
R7098:Ptprc	UTSW	1	138099685	missense	probably benign
R7164:Ptprc	UTSW	1	138117862	missense	probably benign
R7188:Ptprc	UTSW	1	138071180	missense	probably damaging	1.00
R7191:Ptprc	UTSW	1	138101044	missense	probably benign	0.02
R7204:Ptprc	UTSW	1	138117862	missense	probably benign
R7316:Ptprc	UTSW	1	138064771	missense	probably damaging	1.00
R7644:Ptprc	UTSW	1	138067907	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CCAGCTGCCTATTGTGAGTG -3'
(R):5'- ATTCCCTGCACAGATAGGGAG -3'

Sequencing Primer
(F):5'- CCTATTGTGAGTGGCCTGGC -3'
(R):5'- GCTGAGGTATGAACTCTAAGTGC -3'

Posted On

2016-04-15