Incidental Mutation 'R4937:Ptprc'
ID380429
Institutional Source Beutler Lab
Gene Symbol Ptprc
Ensembl Gene ENSMUSG00000026395
Gene Nameprotein tyrosine phosphatase, receptor type, C
SynonymsB220, Ly-5, Lyt-4, CD45, T200
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R4937 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location138062861-138175708 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138089500 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 483 (F483L)
Ref Sequence ENSEMBL: ENSMUSP00000138275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182283] [ENSMUST00000182755] [ENSMUST00000183301]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112036
SMART Domains Protein: ENSMUSP00000107667
Gene: ENSMUSG00000026395

DomainStartEndE-ValueType
Pfam:PTP_N 5 30 5.8e-13 PFAM
low complexity region 31 64 N/A INTRINSIC
Pfam:CD45 70 129 1.8e-24 PFAM
FN3 233 317 2.28e0 SMART
FN3 333 411 3.48e-1 SMART
transmembrane domain 426 447 N/A INTRINSIC
PTPc 500 762 7.57e-127 SMART
PTPc 791 1077 1.39e-102 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182283
AA Change: F507L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138800
Gene: ENSMUSG00000026395
AA Change: F507L

DomainStartEndE-ValueType
Pfam:PTP_N 7 32 4.2e-13 PFAM
low complexity region 33 66 N/A INTRINSIC
Pfam:CD45 72 131 2.3e-24 PFAM
FN3 235 319 2.28e0 SMART
FN3 335 413 3.48e-1 SMART
transmembrane domain 428 449 N/A INTRINSIC
PTPc 502 764 7.57e-127 SMART
PTPc 793 1079 1.39e-102 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182755
AA Change: F483L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138275
Gene: ENSMUSG00000026395
AA Change: F483L

DomainStartEndE-ValueType
Pfam:PTP_N 7 34 5.5e-13 PFAM
Pfam:CD45 48 107 2.3e-24 PFAM
FN3 211 295 2.28e0 SMART
FN3 311 389 3.48e-1 SMART
transmembrane domain 404 425 N/A INTRINSIC
PTPc 478 740 7.57e-127 SMART
PTPc 769 1055 1.39e-102 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183301
AA Change: F646L

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138350
Gene: ENSMUSG00000026395
AA Change: F646L

DomainStartEndE-ValueType
Pfam:PTP_N 7 33 2.7e-13 PFAM
low complexity region 111 128 N/A INTRINSIC
low complexity region 170 205 N/A INTRINSIC
Pfam:CD45 211 270 2.1e-24 PFAM
FN3 374 458 2.28e0 SMART
FN3 474 552 3.48e-1 SMART
transmembrane domain 567 588 N/A INTRINSIC
PTPc 641 903 7.57e-127 SMART
PTPc 932 1218 1.39e-102 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mutants have defective T cell, B cell, and NK cell morphology and physiology. Mice carrying an engineered point mutation exhibit lymphoproliferation and autoimmunity that leads to premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,736,201 F597S probably benign Het
4933406M09Rik T A 1: 134,389,976 M162K probably benign Het
Aasdh C A 5: 76,888,654 E347* probably null Het
Abca16 G T 7: 120,527,086 C1155F probably damaging Het
Adam26a T C 8: 43,568,881 D524G probably damaging Het
Adamts20 G C 15: 94,379,775 H269D probably benign Het
Akap9 T A 5: 4,050,145 probably null Het
Akt3 T C 1: 177,050,127 I358M possibly damaging Het
Aldh9a1 G T 1: 167,361,807 A375S probably damaging Het
Alg2 A G 4: 47,473,974 S105P probably benign Het
Amph A G 13: 19,104,345 T335A probably damaging Het
Ank2 C T 3: 126,962,401 V1056M probably damaging Het
Apoh A G 11: 108,407,378 D168G probably benign Het
Arfgef3 C T 10: 18,589,706 A2130T probably damaging Het
Arhgap30 A G 1: 171,403,329 D218G probably benign Het
Ascc3 C T 10: 50,823,798 P1906S probably damaging Het
Atp11b T G 3: 35,807,008 probably null Het
B4galnt2 A G 11: 95,868,429 V343A probably damaging Het
Barhl1 T C 2: 28,909,773 Y280C probably damaging Het
Bcar1 A T 8: 111,721,037 Y103N probably damaging Het
Bid A G 6: 120,895,746 I150T probably benign Het
Ccdc171 T C 4: 83,549,639 S74P probably damaging Het
Ccni A T 5: 93,188,254 probably null Het
Cct8l1 A G 5: 25,516,893 E202G probably benign Het
Cd200r3 A G 16: 44,954,259 K212E probably benign Het
Cdh19 A G 1: 110,889,964 S683P probably damaging Het
Ces2b A T 8: 104,832,781 H93L probably benign Het
Clec4a1 G A 6: 122,930,695 C114Y probably damaging Het
Dcc G T 18: 71,542,249 S636* probably null Het
Dcdc2c T C 12: 28,530,473 D187G possibly damaging Het
Dgkb G T 12: 38,114,658 E150* probably null Het
Dhx30 A G 9: 110,085,961 L884P probably damaging Het
Dmwd T G 7: 19,081,303 probably null Het
Dnah17 T A 11: 118,042,154 N3593Y probably damaging Het
Dnm2 G A 9: 21,481,337 S447N probably benign Het
Elk4 G A 1: 132,017,681 G99D probably damaging Het
Entpd1 A T 19: 40,739,521 probably benign Het
Fam114a1 T A 5: 64,979,727 D4E probably damaging Het
Fam160b1 T C 19: 57,378,637 V204A probably benign Het
Fam166b T A 4: 43,427,514 Q270L possibly damaging Het
Fbln2 A G 6: 91,264,699 D754G probably damaging Het
Foxred2 T C 15: 77,955,835 N85S probably damaging Het
Fut9 A G 4: 25,799,591 probably benign Het
Gm13023 T C 4: 143,793,837 V53A possibly damaging Het
Gm13762 T A 2: 88,973,490 I134F probably damaging Het
Gm14124 C T 2: 150,268,760 H457Y unknown Het
Gm1818 G A 12: 48,559,824 noncoding transcript Het
Gm4894 C A 9: 49,278,700 Q92K unknown Het
Gpx2 T C 12: 76,792,800 I141M probably benign Het
Gusb T C 5: 129,995,485 T476A probably damaging Het
Hmmr G A 11: 40,721,840 T180I possibly damaging Het
Itgbl1 T C 14: 123,973,368 Y493H probably benign Het
Klhdc9 G T 1: 171,360,383 C93* probably null Het
Lpar3 A G 3: 146,284,751 K275E probably damaging Het
Lrp1b A G 2: 40,802,885 probably null Het
Lrrc63 C T 14: 75,084,949 G572S probably damaging Het
Mapk11 A T 15: 89,146,482 D98E probably benign Het
Net1 G A 13: 3,884,905 R374W probably damaging Het
Nlrp4g T A 9: 124,354,005 noncoding transcript Het
Nrap T A 19: 56,347,220 Y923F probably damaging Het
Olfr53 T A 7: 140,652,621 M214K probably benign Het
Olfr811 A T 10: 129,802,063 V154E probably benign Het
Plxnc1 A G 10: 94,841,473 V964A probably damaging Het
Pmfbp1 A G 8: 109,535,866 I731V probably benign Het
Polq T A 16: 37,027,912 S294T probably benign Het
Pomgnt2 T C 9: 121,982,554 D387G probably benign Het
Prmt2 G A 10: 76,221,008 T227I probably damaging Het
Psmd1 T A 1: 86,083,225 F341I probably damaging Het
Ptpn23 T C 9: 110,392,738 M127V probably benign Het
Rab35 A C 5: 115,640,088 I38L probably damaging Het
Rapgef6 A G 11: 54,657,317 T486A probably damaging Het
Rgl3 A T 9: 21,987,708 C68* probably null Het
Rilpl1 T C 5: 124,515,531 E189G possibly damaging Het
Rnf217 T C 10: 31,517,524 I354V probably benign Het
Rspo3 T C 10: 29,506,528 D50G probably damaging Het
Sbno1 A G 5: 124,374,609 S1366P possibly damaging Het
Sema3c A G 5: 17,694,686 D392G probably benign Het
Serpinb9e A T 13: 33,252,952 Y85F probably benign Het
Shprh C T 10: 11,157,119 T283I probably benign Het
Sipa1l1 T C 12: 82,341,329 S110P probably benign Het
Slc16a12 T A 19: 34,675,243 I168F probably damaging Het
Slc23a3 A G 1: 75,132,624 S221P probably damaging Het
Slc35b3 A T 13: 38,932,911 I366K possibly damaging Het
Slc44a5 T C 3: 154,243,615 probably null Het
Slc5a12 A T 2: 110,620,408 D316V probably damaging Het
Ssr3 A G 3: 65,392,453 S29P probably damaging Het
Taf2 G A 15: 55,027,223 Q1055* probably null Het
Them6 A T 15: 74,721,518 D75V probably damaging Het
Tmem159 T C 7: 120,116,312 S120P probably damaging Het
Tom1l2 A G 11: 60,258,918 S239P probably damaging Het
Tspear A G 10: 77,875,043 T500A probably damaging Het
Tubgcp6 G A 15: 89,101,549 A1487V probably damaging Het
Uba7 G A 9: 107,978,991 V522I possibly damaging Het
Virma C A 4: 11,521,147 C901* probably null Het
Vmn1r172 A T 7: 23,659,887 I66F possibly damaging Het
Vmn2r82 A T 10: 79,379,176 Y331F probably benign Het
Wdr55 G A 18: 36,762,398 V143I probably benign Het
Zbtb49 A T 5: 38,213,963 D191E possibly damaging Het
Zfhx4 A G 3: 5,242,011 H99R probably damaging Het
Zfp560 C T 9: 20,347,967 C533Y probably damaging Het
Zfp646 C T 7: 127,879,182 A177V probably benign Het
Zfp653 C T 9: 22,055,778 E604K probably damaging Het
Other mutations in Ptprc
AlleleSourceChrCoordTypePredicted EffectPPH Score
lochy APN 1 138083790 splice site probably benign
IGL00486:Ptprc APN 1 138115621 missense probably damaging 0.97
IGL00771:Ptprc APN 1 138113677 missense probably benign 0.00
IGL00833:Ptprc APN 1 138078492 missense possibly damaging 0.55
IGL00919:Ptprc APN 1 138113642 missense probably damaging 1.00
IGL01020:Ptprc APN 1 138120173 critical splice acceptor site probably null 0.00
IGL01024:Ptprc APN 1 138080912 missense probably damaging 1.00
IGL01302:Ptprc APN 1 138099631 missense possibly damaging 0.82
IGL01548:Ptprc APN 1 138099481 critical splice donor site probably null 0.00
IGL01620:Ptprc APN 1 138068410 missense possibly damaging 0.88
IGL01775:Ptprc APN 1 138064759 missense probably damaging 1.00
IGL01820:Ptprc APN 1 138066198 missense probably damaging 1.00
IGL02340:Ptprc APN 1 138071219 missense probably damaging 1.00
IGL02943:Ptprc APN 1 138099513 missense probably damaging 0.99
IGL03169:Ptprc APN 1 138113619 missense probably benign 0.15
IGL03308:Ptprc APN 1 138126320 missense possibly damaging 0.70
IGL03404:Ptprc APN 1 138093001 missense probably damaging 1.00
belittle UTSW 1 138137493 intron probably benign
Chor_muang UTSW 1 138113562 critical splice donor site probably null
Dumpling UTSW 1 138067890 missense probably damaging 1.00
fuchsia UTSW 1 138101041 critical splice donor site probably null
guotie UTSW 1 138068401 nonsense probably null
guotie2 UTSW 1 138094299 missense probably damaging 0.97
Guotie3 UTSW 1 138078451 missense possibly damaging 0.92
Gyoza UTSW 1 138083567 missense probably damaging 1.00
Half_measure UTSW 1 138071249 missense probably damaging 0.98
jirisan UTSW 1 138113678 nonsense probably null
R0013:Ptprc UTSW 1 138113559 unclassified probably null
R0189:Ptprc UTSW 1 138082715 missense probably benign 0.10
R0390:Ptprc UTSW 1 138122575 missense possibly damaging 0.71
R0504:Ptprc UTSW 1 138088697 missense probably damaging 1.00
R0602:Ptprc UTSW 1 138089485 splice site probably benign
R0627:Ptprc UTSW 1 138068320 missense probably damaging 0.99
R0632:Ptprc UTSW 1 138073610 missense probably benign 0.01
R0751:Ptprc UTSW 1 138092930 missense probably damaging 1.00
R0839:Ptprc UTSW 1 138101132 missense possibly damaging 0.47
R0942:Ptprc UTSW 1 138068401 nonsense probably null
R0943:Ptprc UTSW 1 138111164 missense probably damaging 0.96
R1159:Ptprc UTSW 1 138072319 missense probably damaging 1.00
R1442:Ptprc UTSW 1 138072312 missense probably damaging 1.00
R1489:Ptprc UTSW 1 138120086 missense possibly damaging 0.91
R1728:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1728:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1728:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1728:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1728:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1729:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1729:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1729:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1729:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1729:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1730:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1730:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1730:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1730:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1730:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1739:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1739:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1739:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1739:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1739:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1762:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1762:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1762:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1762:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1762:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1783:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1783:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1783:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1783:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1783:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1784:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1784:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1784:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1784:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1784:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1785:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1785:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1785:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1785:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1785:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1862:Ptprc UTSW 1 138112227 missense probably benign 0.13
R2145:Ptprc UTSW 1 138073681 missense probably damaging 1.00
R2290:Ptprc UTSW 1 138111188 missense probably benign 0.00
R2403:Ptprc UTSW 1 138088532 missense probably damaging 1.00
R2439:Ptprc UTSW 1 138066152 missense possibly damaging 0.67
R2887:Ptprc UTSW 1 138080178 missense probably damaging 1.00
R2906:Ptprc UTSW 1 138064534 missense possibly damaging 0.93
R3774:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3775:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3776:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3834:Ptprc UTSW 1 138083567 missense probably damaging 1.00
R4019:Ptprc UTSW 1 138078516 missense probably damaging 1.00
R4377:Ptprc UTSW 1 138067925 missense probably benign 0.04
R4580:Ptprc UTSW 1 138071251 missense probably benign 0.09
R4923:Ptprc UTSW 1 138078498 missense possibly damaging 0.93
R4925:Ptprc UTSW 1 138099497 missense probably benign 0.04
R4970:Ptprc UTSW 1 138094299 missense probably damaging 0.97
R5112:Ptprc UTSW 1 138094299 missense probably damaging 0.97
R5145:Ptprc UTSW 1 138089566 missense probably benign 0.07
R5158:Ptprc UTSW 1 138175084 missense possibly damaging 0.75
R5223:Ptprc UTSW 1 138117862 missense probably benign
R5593:Ptprc UTSW 1 138117720 intron probably benign
R5689:Ptprc UTSW 1 138117777 missense probably benign 0.01
R5885:Ptprc UTSW 1 138088508 missense probably damaging 1.00
R6010:Ptprc UTSW 1 138101056 missense probably benign 0.09
R6026:Ptprc UTSW 1 138071249 missense probably damaging 0.98
R6047:Ptprc UTSW 1 138101041 critical splice donor site probably null
R6173:Ptprc UTSW 1 138067890 missense probably damaging 1.00
R6328:Ptprc UTSW 1 138113678 nonsense probably null
R6383:Ptprc UTSW 1 138078451 missense possibly damaging 0.92
R6436:Ptprc UTSW 1 138083639 missense possibly damaging 0.77
R6492:Ptprc UTSW 1 138113562 critical splice donor site probably null
R6520:Ptprc UTSW 1 138080143 nonsense probably null
R6805:Ptprc UTSW 1 138067885 critical splice donor site probably null
R6830:Ptprc UTSW 1 138072255 critical splice donor site probably null
R6847:Ptprc UTSW 1 138088545 missense probably damaging 0.99
R6960:Ptprc UTSW 1 138078445 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCAGCTGCCTATTGTGAGTG -3'
(R):5'- ATTCCCTGCACAGATAGGGAG -3'

Sequencing Primer
(F):5'- CCTATTGTGAGTGGCCTGGC -3'
(R):5'- GCTGAGGTATGAACTCTAAGTGC -3'
Posted On2016-04-15