Mutagenetix > Incidental Mutations

Incidental Mutation 'R4937:Akt3'

380433

Institutional Source

Beutler Lab

Gene Symbol

Akt3

Ensembl Gene

ENSMUSG00000019699

Gene Name

thymoma viral proto-oncogene 3

Synonyms

D930002M15Rik, Nmf350, PKB gamma

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.646) question?

Stock #

R4937 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

177020073-177258203 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 177050127 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 358 (I358M)

Ref Sequence

ENSEMBL: ENSMUSP00000106790 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019843] [ENSMUST00000111159] [ENSMUST00000111160]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000019843
AA Change: I358M

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000019843
Gene: ENSMUSG00000019699
AA Change: I358M

Domain	Start	End	E-Value	Type
PH	6	109	4.81e-16	SMART
S_TKc	148	405	3.53e-106	SMART
S_TK_X	406	467	6.37e-12	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111159
AA Change: I358M

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000106789
Gene: ENSMUSG00000019699
AA Change: I358M

Domain	Start	End	E-Value	Type
PH	6	109	4.81e-16	SMART
S_TKc	148	405	3.53e-106	SMART
S_TK_X	406	475	2.61e-17	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111160
AA Change: I358M

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000106790
Gene: ENSMUSG00000019699
AA Change: I358M

Domain	Start	End	E-Value	Type
PH	6	109	4.81e-16	SMART
S_TKc	148	405	3.53e-106	SMART
S_TK_X	406	475	2.61e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193760

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.1%
20x: 88.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the AKT, also called PKB, serine/threonine protein kinase family. AKT kinases are known to be regulators of cell signaling in response to insulin and growth factors. They are involved in a wide variety of biological processes including cell proliferation, differentiation, apoptosis, tumorigenesis, as well as glycogen synthesis and glucose uptake. This kinase has been shown to be stimulated by platelet-derived growth factor (PDGF), insulin, and insulin-like growth factor 1 (IGF1). Alternatively splice transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a 20% decrease in brain size and have smaller and fewer cells in the brain. Mice heterozygous for an ENU-induced mutation exhibit increased seizures (sporadic and induced) and increased brain weight and size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	G	5: 109,736,201	F597S	probably benign	Het
4933406M09Rik	T	A	1: 134,389,976	M162K	probably benign	Het
Aasdh	C	A	5: 76,888,654	E347*	probably null	Het
Abca16	G	T	7: 120,527,086	C1155F	probably damaging	Het
Adam26a	T	C	8: 43,568,881	D524G	probably damaging	Het
Adamts20	G	C	15: 94,379,775	H269D	probably benign	Het
Akap9	T	A	5: 4,050,145		probably null	Het
Aldh9a1	G	T	1: 167,361,807	A375S	probably damaging	Het
Alg2	A	G	4: 47,473,974	S105P	probably benign	Het
Amph	A	G	13: 19,104,345	T335A	probably damaging	Het
Ank2	C	T	3: 126,962,401	V1056M	probably damaging	Het
Apoh	A	G	11: 108,407,378	D168G	probably benign	Het
Arfgef3	C	T	10: 18,589,706	A2130T	probably damaging	Het
Arhgap30	A	G	1: 171,403,329	D218G	probably benign	Het
Ascc3	C	T	10: 50,823,798	P1906S	probably damaging	Het
Atp11b	T	G	3: 35,807,008		probably null	Het
B4galnt2	A	G	11: 95,868,429	V343A	probably damaging	Het
Barhl1	T	C	2: 28,909,773	Y280C	probably damaging	Het
Bcar1	A	T	8: 111,721,037	Y103N	probably damaging	Het
Bid	A	G	6: 120,895,746	I150T	probably benign	Het
Ccdc171	T	C	4: 83,549,639	S74P	probably damaging	Het
Ccni	A	T	5: 93,188,254		probably null	Het
Cct8l1	A	G	5: 25,516,893	E202G	probably benign	Het
Cd200r3	A	G	16: 44,954,259	K212E	probably benign	Het
Cdh19	A	G	1: 110,889,964	S683P	probably damaging	Het
Ces2b	A	T	8: 104,832,781	H93L	probably benign	Het
Clec4a1	G	A	6: 122,930,695	C114Y	probably damaging	Het
Dcc	G	T	18: 71,542,249	S636*	probably null	Het
Dcdc2c	T	C	12: 28,530,473	D187G	possibly damaging	Het
Dgkb	G	T	12: 38,114,658	E150*	probably null	Het
Dhx30	A	G	9: 110,085,961	L884P	probably damaging	Het
Dmwd	T	G	7: 19,081,303		probably null	Het
Dnah17	T	A	11: 118,042,154	N3593Y	probably damaging	Het
Dnm2	G	A	9: 21,481,337	S447N	probably benign	Het
Elk4	G	A	1: 132,017,681	G99D	probably damaging	Het
Entpd1	A	T	19: 40,739,521		probably benign	Het
Fam114a1	T	A	5: 64,979,727	D4E	probably damaging	Het
Fam160b1	T	C	19: 57,378,637	V204A	probably benign	Het
Fam166b	T	A	4: 43,427,514	Q270L	possibly damaging	Het
Fbln2	A	G	6: 91,264,699	D754G	probably damaging	Het
Foxred2	T	C	15: 77,955,835	N85S	probably damaging	Het
Fut9	A	G	4: 25,799,591		probably benign	Het
Gm13023	T	C	4: 143,793,837	V53A	possibly damaging	Het
Gm13762	T	A	2: 88,973,490	I134F	probably damaging	Het
Gm14124	C	T	2: 150,268,760	H457Y	unknown	Het
Gm1818	G	A	12: 48,559,824		noncoding transcript	Het
Gm4894	C	A	9: 49,278,700	Q92K	unknown	Het
Gpx2	T	C	12: 76,792,800	I141M	probably benign	Het
Gusb	T	C	5: 129,995,485	T476A	probably damaging	Het
Hmmr	G	A	11: 40,721,840	T180I	possibly damaging	Het
Itgbl1	T	C	14: 123,973,368	Y493H	probably benign	Het
Klhdc9	G	T	1: 171,360,383	C93*	probably null	Het
Lpar3	A	G	3: 146,284,751	K275E	probably damaging	Het
Lrp1b	A	G	2: 40,802,885		probably null	Het
Lrrc63	C	T	14: 75,084,949	G572S	probably damaging	Het
Mapk11	A	T	15: 89,146,482	D98E	probably benign	Het
Net1	G	A	13: 3,884,905	R374W	probably damaging	Het
Nlrp4g	T	A	9: 124,354,005		noncoding transcript	Het
Nrap	T	A	19: 56,347,220	Y923F	probably damaging	Het
Olfr53	T	A	7: 140,652,621	M214K	probably benign	Het
Olfr811	A	T	10: 129,802,063	V154E	probably benign	Het
Plxnc1	A	G	10: 94,841,473	V964A	probably damaging	Het
Pmfbp1	A	G	8: 109,535,866	I731V	probably benign	Het
Polq	T	A	16: 37,027,912	S294T	probably benign	Het
Pomgnt2	T	C	9: 121,982,554	D387G	probably benign	Het
Prmt2	G	A	10: 76,221,008	T227I	probably damaging	Het
Psmd1	T	A	1: 86,083,225	F341I	probably damaging	Het
Ptpn23	T	C	9: 110,392,738	M127V	probably benign	Het
Ptprc	A	G	1: 138,089,500	F483L	probably damaging	Het
Rab35	A	C	5: 115,640,088	I38L	probably damaging	Het
Rapgef6	A	G	11: 54,657,317	T486A	probably damaging	Het
Rgl3	A	T	9: 21,987,708	C68*	probably null	Het
Rilpl1	T	C	5: 124,515,531	E189G	possibly damaging	Het
Rnf217	T	C	10: 31,517,524	I354V	probably benign	Het
Rspo3	T	C	10: 29,506,528	D50G	probably damaging	Het
Sbno1	A	G	5: 124,374,609	S1366P	possibly damaging	Het
Sema3c	A	G	5: 17,694,686	D392G	probably benign	Het
Serpinb9e	A	T	13: 33,252,952	Y85F	probably benign	Het
Shprh	C	T	10: 11,157,119	T283I	probably benign	Het
Sipa1l1	T	C	12: 82,341,329	S110P	probably benign	Het
Slc16a12	T	A	19: 34,675,243	I168F	probably damaging	Het
Slc23a3	A	G	1: 75,132,624	S221P	probably damaging	Het
Slc35b3	A	T	13: 38,932,911	I366K	possibly damaging	Het
Slc44a5	T	C	3: 154,243,615		probably null	Het
Slc5a12	A	T	2: 110,620,408	D316V	probably damaging	Het
Ssr3	A	G	3: 65,392,453	S29P	probably damaging	Het
Taf2	G	A	15: 55,027,223	Q1055*	probably null	Het
Them6	A	T	15: 74,721,518	D75V	probably damaging	Het
Tmem159	T	C	7: 120,116,312	S120P	probably damaging	Het
Tom1l2	A	G	11: 60,258,918	S239P	probably damaging	Het
Tspear	A	G	10: 77,875,043	T500A	probably damaging	Het
Tubgcp6	G	A	15: 89,101,549	A1487V	probably damaging	Het
Uba7	G	A	9: 107,978,991	V522I	possibly damaging	Het
Virma	C	A	4: 11,521,147	C901*	probably null	Het
Vmn1r172	A	T	7: 23,659,887	I66F	possibly damaging	Het
Vmn2r82	A	T	10: 79,379,176	Y331F	probably benign	Het
Wdr55	G	A	18: 36,762,398	V143I	probably benign	Het
Zbtb49	A	T	5: 38,213,963	D191E	possibly damaging	Het
Zfhx4	A	G	3: 5,242,011	H99R	probably damaging	Het
Zfp560	C	T	9: 20,347,967	C533Y	probably damaging	Het
Zfp646	C	T	7: 127,879,182	A177V	probably benign	Het
Zfp653	C	T	9: 22,055,778	E604K	probably damaging	Het

Other mutations in Akt3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01020:Akt3	APN	1	177130967	splice site	probably benign
IGL02348:Akt3	APN	1	177059386	missense	probably damaging	0.99
IGL02394:Akt3	APN	1	177059419	missense	probably damaging	1.00
IGL03005:Akt3	APN	1	177067227	missense	probably damaging	1.00
R0114:Akt3	UTSW	1	177067251	missense	probably damaging	1.00
R1403:Akt3	UTSW	1	177131110	splice site	probably benign
R1452:Akt3	UTSW	1	177131067	missense	possibly damaging	0.93
R1495:Akt3	UTSW	1	177103042	missense	probably benign
R1961:Akt3	UTSW	1	177096995	missense	probably damaging	0.97
R2062:Akt3	UTSW	1	177102985	missense	possibly damaging	0.93
R2064:Akt3	UTSW	1	177102985	missense	possibly damaging	0.93
R2066:Akt3	UTSW	1	177102985	missense	possibly damaging	0.93
R2068:Akt3	UTSW	1	177102985	missense	possibly damaging	0.93
R4155:Akt3	UTSW	1	177096977	missense	possibly damaging	0.92
R5097:Akt3	UTSW	1	177248688	missense	probably benign	0.01
R5414:Akt3	UTSW	1	177050251	missense	probably damaging	0.98
R6336:Akt3	UTSW	1	177031712	missense	probably damaging	1.00
R6723:Akt3	UTSW	1	177050190	nonsense	probably null
R6752:Akt3	UTSW	1	177050190	nonsense	probably null
R6753:Akt3	UTSW	1	177050190	nonsense	probably null
R6755:Akt3	UTSW	1	177050190	nonsense	probably null
R6765:Akt3	UTSW	1	177050190	nonsense	probably null
R6766:Akt3	UTSW	1	177050190	nonsense	probably null
R6767:Akt3	UTSW	1	177050190	nonsense	probably null
R6782:Akt3	UTSW	1	177050190	nonsense	probably null
R6787:Akt3	UTSW	1	177050190	nonsense	probably null
R6847:Akt3	UTSW	1	177031659	missense	probably damaging	1.00
R7525:Akt3	UTSW	1	177020107	nonsense	probably null
R7535:Akt3	UTSW	1	177097034	missense	probably damaging	1.00
R8000:Akt3	UTSW	1	177050197	missense	probably damaging	1.00
R8326:Akt3	UTSW	1	177050045	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- GCTTCCAGAAATCAGGCATATTTG -3'
(R):5'- AGTTGCAGCTCCATAGGTTGTC -3'

Sequencing Primer
(F):5'- GATCCTTTATCAAGAGCCCT -3'
(R):5'- GGCTAGTCTACATAGCAAGTTCCAG -3'

Posted On

2016-04-15