Mutagenetix > Incidental Mutation

Incidental Mutation 'R4937:Ank2'

380446

Institutional Source

Beutler Lab

Gene Symbol

Ank2

Ensembl Gene

ENSMUSG00000032826

Gene Name

ankyrin 2, brain

Synonyms

Ankyrin-B, Ank-2, Ankyrin-2, Gm4392, ankyrin B

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4937 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

126921612-127499350 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 126962401 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 1056 (V1056M)

Ref Sequence

ENSEMBL: ENSMUSP00000138251 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044443] [ENSMUST00000182064] [ENSMUST00000182078] [ENSMUST00000182711] [ENSMUST00000182959] [ENSMUST00000211813]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000044443
AA Change: V206M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043765
Gene: ENSMUSG00000032826
AA Change: V206M

Domain	Start	End	E-Value	Type
low complexity region	9	22	N/A	INTRINSIC
low complexity region	57	69	N/A	INTRINSIC
ZU5	128	232	4.13e-61	SMART
Pfam:ZU5	289	374	2.8e-8	PFAM
low complexity region	587	597	N/A	INTRINSIC
DEATH	603	697	1.52e-27	SMART
low complexity region	732	748	N/A	INTRINSIC
low complexity region	860	873	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000182064
AA Change: V1077M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138620
Gene: ENSMUSG00000032826
AA Change: V1077M

Domain	Start	End	E-Value	Type
ANK	9	38	1e1	SMART
ANK	42	71	8.9e-7	SMART
ANK	75	104	4.4e-9	SMART
ANK	108	137	2.8e-9	SMART
ANK	141	169	5.3e-1	SMART
ANK	170	199	7.3e-1	SMART
ANK	211	240	1.1e-7	SMART
ANK	244	273	4.4e-9	SMART
ANK	277	306	9.3e-8	SMART
ANK	310	339	2.1e-8	SMART
ANK	343	372	1.3e-7	SMART
ANK	376	405	6.2e-9	SMART
ANK	409	438	1.1e-7	SMART
ANK	442	471	2.9e-8	SMART
ANK	475	504	1.1e-5	SMART
ANK	508	537	6.5e-6	SMART
ANK	541	570	2.3e-7	SMART
ANK	574	603	2.4e-7	SMART
ANK	607	636	3.2e-9	SMART
ANK	640	669	5.5e-5	SMART
ANK	673	702	1.9e-8	SMART
ANK	706	735	3.3e-9	SMART
low complexity region	755	775	N/A	INTRINSIC
low complexity region	793	806	N/A	INTRINSIC
low complexity region	841	853	N/A	INTRINSIC
ZU5	912	1016	2e-63	SMART
low complexity region	1371	1381	N/A	INTRINSIC
low complexity region	1448	1463	N/A	INTRINSIC
low complexity region	1490	1503	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000182078
AA Change: V990M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138753
Gene: ENSMUSG00000032826
AA Change: V990M

Domain	Start	End	E-Value	Type
low complexity region	7	18	N/A	INTRINSIC
low complexity region	114	125	N/A	INTRINSIC
low complexity region	191	209	N/A	INTRINSIC
low complexity region	304	312	N/A	INTRINSIC
low complexity region	478	493	N/A	INTRINSIC
low complexity region	527	544	N/A	INTRINSIC
DEATH	591	685	1e-29	SMART
low complexity region	720	736	N/A	INTRINSIC
low complexity region	848	861	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000182711
AA Change: V1072M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138781
Gene: ENSMUSG00000032826
AA Change: V1072M

Domain	Start	End	E-Value	Type
ANK	26	55	1e1	SMART
ANK	59	88	8.9e-7	SMART
ANK	92	121	4.4e-9	SMART
ANK	125	154	2.8e-9	SMART
ANK	158	186	5.3e-1	SMART
ANK	187	216	7.3e-1	SMART
ANK	228	257	1.1e-7	SMART
ANK	261	290	4.4e-9	SMART
ANK	294	323	9.3e-8	SMART
ANK	327	356	2.1e-8	SMART
ANK	360	389	1.3e-7	SMART
ANK	393	422	6.2e-9	SMART
ANK	426	455	1.1e-7	SMART
ANK	459	488	2.9e-8	SMART
ANK	492	521	1.1e-5	SMART
ANK	525	554	6.5e-6	SMART
ANK	558	587	2.3e-7	SMART
ANK	591	620	5.3e-7	SMART
ANK	624	653	2.4e-7	SMART
ANK	657	686	3.2e-9	SMART
ANK	690	719	5.5e-5	SMART
ANK	723	752	1.9e-8	SMART
ANK	756	785	3.3e-9	SMART
low complexity region	805	825	N/A	INTRINSIC
low complexity region	843	856	N/A	INTRINSIC
ZU5	961	1098	1.1e-50	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000182959
AA Change: V1056M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138251
Gene: ENSMUSG00000032826
AA Change: V1056M

Domain	Start	End	E-Value	Type
ANK	9	38	1.63e3	SMART
ANK	42	71	1.4e-4	SMART
ANK	75	104	6.76e-7	SMART
ANK	108	137	4.46e-7	SMART
ANK	141	169	8.36e1	SMART
ANK	170	199	1.17e2	SMART
ANK	211	240	1.76e-5	SMART
ANK	244	273	6.76e-7	SMART
ANK	277	306	1.43e-5	SMART
ANK	310	339	3.33e-6	SMART
ANK	343	372	2.02e-5	SMART
ANK	376	405	9.55e-7	SMART
ANK	409	438	1.76e-5	SMART
ANK	442	471	4.71e-6	SMART
ANK	475	504	1.7e-3	SMART
ANK	508	537	1.05e-3	SMART
ANK	541	570	3.51e-5	SMART
ANK	574	603	8.65e-5	SMART
ANK	607	636	3.76e-5	SMART
ANK	640	669	5.12e-7	SMART
ANK	673	702	8.39e-3	SMART
ANK	706	735	2.9e-6	SMART
ANK	739	768	5.12e-7	SMART
low complexity region	788	808	N/A	INTRINSIC
low complexity region	826	839	N/A	INTRINSIC
low complexity region	874	886	N/A	INTRINSIC
Pfam:ZU5	945	1028	1.5e-30	PFAM
Pfam:ZU5	1021	1082	4.4e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183075

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196018

Predicted Effect

probably benign
Transcript: ENSMUST00000211813

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.1%
20x: 88.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous mutation of this gene results in death by postnatal day 8, although some animals survive to P20. Mutant animals display reduced body size, impaired balance and locomotion, brain structure dysmorphologies, abnormal lens, and optic nerve degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	G	5: 109,736,201	F597S	probably benign	Het
4933406M09Rik	T	A	1: 134,389,976	M162K	probably benign	Het
Aasdh	C	A	5: 76,888,654	E347*	probably null	Het
Abca16	G	T	7: 120,527,086	C1155F	probably damaging	Het
Adam26a	T	C	8: 43,568,881	D524G	probably damaging	Het
Adamts20	G	C	15: 94,379,775	H269D	probably benign	Het
Akap9	T	A	5: 4,050,145		probably null	Het
Akt3	T	C	1: 177,050,127	I358M	possibly damaging	Het
Aldh9a1	G	T	1: 167,361,807	A375S	probably damaging	Het
Alg2	A	G	4: 47,473,974	S105P	probably benign	Het
Amph	A	G	13: 19,104,345	T335A	probably damaging	Het
Apoh	A	G	11: 108,407,378	D168G	probably benign	Het
Arfgef3	C	T	10: 18,589,706	A2130T	probably damaging	Het
Arhgap30	A	G	1: 171,403,329	D218G	probably benign	Het
Ascc3	C	T	10: 50,823,798	P1906S	probably damaging	Het
Atp11b	T	G	3: 35,807,008		probably null	Het
B4galnt2	A	G	11: 95,868,429	V343A	probably damaging	Het
Barhl1	T	C	2: 28,909,773	Y280C	probably damaging	Het
Bcar1	A	T	8: 111,721,037	Y103N	probably damaging	Het
Bid	A	G	6: 120,895,746	I150T	probably benign	Het
Ccdc171	T	C	4: 83,549,639	S74P	probably damaging	Het
Ccni	A	T	5: 93,188,254		probably null	Het
Cct8l1	A	G	5: 25,516,893	E202G	probably benign	Het
Cd200r3	A	G	16: 44,954,259	K212E	probably benign	Het
Cdh19	A	G	1: 110,889,964	S683P	probably damaging	Het
Ces2b	A	T	8: 104,832,781	H93L	probably benign	Het
Clec4a1	G	A	6: 122,930,695	C114Y	probably damaging	Het
Dcc	G	T	18: 71,542,249	S636*	probably null	Het
Dcdc2c	T	C	12: 28,530,473	D187G	possibly damaging	Het
Dgkb	G	T	12: 38,114,658	E150*	probably null	Het
Dhx30	A	G	9: 110,085,961	L884P	probably damaging	Het
Dmwd	T	G	7: 19,081,303		probably null	Het
Dnah17	T	A	11: 118,042,154	N3593Y	probably damaging	Het
Dnm2	G	A	9: 21,481,337	S447N	probably benign	Het
Elk4	G	A	1: 132,017,681	G99D	probably damaging	Het
Entpd1	A	T	19: 40,739,521		probably benign	Het
Fam114a1	T	A	5: 64,979,727	D4E	probably damaging	Het
Fam160b1	T	C	19: 57,378,637	V204A	probably benign	Het
Fam166b	T	A	4: 43,427,514	Q270L	possibly damaging	Het
Fbln2	A	G	6: 91,264,699	D754G	probably damaging	Het
Foxred2	T	C	15: 77,955,835	N85S	probably damaging	Het
Fut9	A	G	4: 25,799,591		probably benign	Het
Gm13023	T	C	4: 143,793,837	V53A	possibly damaging	Het
Gm13762	T	A	2: 88,973,490	I134F	probably damaging	Het
Gm14124	C	T	2: 150,268,760	H457Y	unknown	Het
Gm1818	G	A	12: 48,559,824		noncoding transcript	Het
Gm4894	C	A	9: 49,278,700	Q92K	unknown	Het
Gpx2	T	C	12: 76,792,800	I141M	probably benign	Het
Gusb	T	C	5: 129,995,485	T476A	probably damaging	Het
Hmmr	G	A	11: 40,721,840	T180I	possibly damaging	Het
Itgbl1	T	C	14: 123,973,368	Y493H	probably benign	Het
Klhdc9	G	T	1: 171,360,383	C93*	probably null	Het
Lpar3	A	G	3: 146,284,751	K275E	probably damaging	Het
Lrp1b	A	G	2: 40,802,885		probably null	Het
Lrrc63	C	T	14: 75,084,949	G572S	probably damaging	Het
Mapk11	A	T	15: 89,146,482	D98E	probably benign	Het
Net1	G	A	13: 3,884,905	R374W	probably damaging	Het
Nlrp4g	T	A	9: 124,354,005		noncoding transcript	Het
Nrap	T	A	19: 56,347,220	Y923F	probably damaging	Het
Olfr53	T	A	7: 140,652,621	M214K	probably benign	Het
Olfr811	A	T	10: 129,802,063	V154E	probably benign	Het
Plxnc1	A	G	10: 94,841,473	V964A	probably damaging	Het
Pmfbp1	A	G	8: 109,535,866	I731V	probably benign	Het
Polq	T	A	16: 37,027,912	S294T	probably benign	Het
Pomgnt2	T	C	9: 121,982,554	D387G	probably benign	Het
Prmt2	G	A	10: 76,221,008	T227I	probably damaging	Het
Psmd1	T	A	1: 86,083,225	F341I	probably damaging	Het
Ptpn23	T	C	9: 110,392,738	M127V	probably benign	Het
Ptprc	A	G	1: 138,089,500	F483L	probably damaging	Het
Rab35	A	C	5: 115,640,088	I38L	probably damaging	Het
Rapgef6	A	G	11: 54,657,317	T486A	probably damaging	Het
Rgl3	A	T	9: 21,987,708	C68*	probably null	Het
Rilpl1	T	C	5: 124,515,531	E189G	possibly damaging	Het
Rnf217	T	C	10: 31,517,524	I354V	probably benign	Het
Rspo3	T	C	10: 29,506,528	D50G	probably damaging	Het
Sbno1	A	G	5: 124,374,609	S1366P	possibly damaging	Het
Sema3c	A	G	5: 17,694,686	D392G	probably benign	Het
Serpinb9e	A	T	13: 33,252,952	Y85F	probably benign	Het
Shprh	C	T	10: 11,157,119	T283I	probably benign	Het
Sipa1l1	T	C	12: 82,341,329	S110P	probably benign	Het
Slc16a12	T	A	19: 34,675,243	I168F	probably damaging	Het
Slc23a3	A	G	1: 75,132,624	S221P	probably damaging	Het
Slc35b3	A	T	13: 38,932,911	I366K	possibly damaging	Het
Slc44a5	T	C	3: 154,243,615		probably null	Het
Slc5a12	A	T	2: 110,620,408	D316V	probably damaging	Het
Ssr3	A	G	3: 65,392,453	S29P	probably damaging	Het
Taf2	G	A	15: 55,027,223	Q1055*	probably null	Het
Them6	A	T	15: 74,721,518	D75V	probably damaging	Het
Tmem159	T	C	7: 120,116,312	S120P	probably damaging	Het
Tom1l2	A	G	11: 60,258,918	S239P	probably damaging	Het
Tspear	A	G	10: 77,875,043	T500A	probably damaging	Het
Tubgcp6	G	A	15: 89,101,549	A1487V	probably damaging	Het
Uba7	G	A	9: 107,978,991	V522I	possibly damaging	Het
Virma	C	A	4: 11,521,147	C901*	probably null	Het
Vmn1r172	A	T	7: 23,659,887	I66F	possibly damaging	Het
Vmn2r82	A	T	10: 79,379,176	Y331F	probably benign	Het
Wdr55	G	A	18: 36,762,398	V143I	probably benign	Het
Zbtb49	A	T	5: 38,213,963	D191E	possibly damaging	Het
Zfhx4	A	G	3: 5,242,011	H99R	probably damaging	Het
Zfp560	C	T	9: 20,347,967	C533Y	probably damaging	Het
Zfp646	C	T	7: 127,879,182	A177V	probably benign	Het
Zfp653	C	T	9: 22,055,778	E604K	probably damaging	Het

Other mutations in Ank2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01298:Ank2	APN	3	126959720	missense	possibly damaging	0.80
IGL01652:Ank2	APN	3	126933041	missense	probably benign	0.00
IGL01969:Ank2	APN	3	126953223	missense	possibly damaging	0.47
IGL02122:Ank2	APN	3	126937874	splice site	probably benign
IGL02537:Ank2	APN	3	126955916	missense	probably damaging	1.00
IGL02858:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL02981:Ank2	APN	3	126934562	missense	possibly damaging	0.58
IGL02981:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03024:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03074:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03111:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03129:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03174:Ank2	APN	3	126940095	missense	probably damaging	0.98
IGL03177:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03185:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03188:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03242:Ank2	APN	3	126928805	missense	possibly damaging	0.90
IGL03244:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03248:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03285:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03304:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03358:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03380:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03389:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03400:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03409:Ank2	APN	3	126955870	missense	probably damaging	1.00
ballast	UTSW	3	126943133	missense	unknown
Chain	UTSW	3	126946938	intron	probably benign
Deadman	UTSW	3	126929822	missense	probably benign	0.19
drag	UTSW	3	127003982	missense	probably damaging	1.00
mooring	UTSW	3	126934577	missense	possibly damaging	0.73
Treasure	UTSW	3	126946749	missense	unknown
Windlass	UTSW	3	126946149	missense	probably benign
R0033:Ank2	UTSW	3	127104748	splice site	probably benign
R0042:Ank2	UTSW	3	126936631	missense	probably damaging	0.99
R0042:Ank2	UTSW	3	126936631	missense	probably damaging	0.99
R0079:Ank2	UTSW	3	126934615	missense	probably benign	0.01
R0423:Ank2	UTSW	3	126929860	nonsense	probably null
R0699:Ank2	UTSW	3	126929829	missense	probably benign	0.00
R0724:Ank2	UTSW	3	126962337	missense	probably damaging	1.00
R0990:Ank2	UTSW	3	126934666	missense	possibly damaging	0.64
R1450:Ank2	UTSW	3	126957302	missense	possibly damaging	0.94
R1500:Ank2	UTSW	3	126932982	missense	probably benign
R1702:Ank2	UTSW	3	126955899	missense	probably benign	0.00
R1703:Ank2	UTSW	3	126929766	missense	probably damaging	1.00
R1710:Ank2	UTSW	3	126933060	nonsense	probably null
R1743:Ank2	UTSW	3	126928675	missense	probably damaging	0.99
R1775:Ank2	UTSW	3	126934547	missense	probably benign	0.00
R1852:Ank2	UTSW	3	126997851	critical splice donor site	probably null
R2198:Ank2	UTSW	3	126934577	missense	possibly damaging	0.73
R2892:Ank2	UTSW	3	127248243	splice site	probably null
R2893:Ank2	UTSW	3	127248243	splice site	probably null
R2894:Ank2	UTSW	3	127248243	splice site	probably null
R3148:Ank2	UTSW	3	126933075	missense	probably benign	0.00
R3776:Ank2	UTSW	3	126942262	intron	probably benign
R3784:Ank2	UTSW	3	126953193	missense	probably damaging	1.00
R3856:Ank2	UTSW	3	126929844	missense	probably benign	0.00
R3906:Ank2	UTSW	3	127016898	missense	probably damaging	1.00
R3907:Ank2	UTSW	3	127016898	missense	probably damaging	1.00
R3953:Ank2	UTSW	3	126988160	missense	probably damaging	1.00
R3963:Ank2	UTSW	3	126934596	missense	probably benign
R4367:Ank2	UTSW	3	126946149	missense	probably benign
R4414:Ank2	UTSW	3	127225762	critical splice donor site	probably null
R4432:Ank2	UTSW	3	126947806	intron	probably benign
R4433:Ank2	UTSW	3	126947806	intron	probably benign
R4579:Ank2	UTSW	3	126958963	missense	probably damaging	1.00
R4597:Ank2	UTSW	3	126988151	missense	probably damaging	1.00
R4603:Ank2	UTSW	3	127032016	missense	probably benign	0.00
R4729:Ank2	UTSW	3	126976896	nonsense	probably null
R4815:Ank2	UTSW	3	126936761	missense	probably benign
R4826:Ank2	UTSW	3	126956001	missense	probably benign	0.35
R4871:Ank2	UTSW	3	126959795	missense	probably damaging	1.00
R4880:Ank2	UTSW	3	127046826	splice site	probably null
R4915:Ank2	UTSW	3	126942671	intron	probably benign
R4935:Ank2	UTSW	3	126956064	missense	probably damaging	1.00
R4936:Ank2	UTSW	3	126955039	missense	possibly damaging	0.94
R4946:Ank2	UTSW	3	126941940	intron	probably benign
R4963:Ank2	UTSW	3	127032096	missense	probably benign	0.01
R4989:Ank2	UTSW	3	126963445	missense	possibly damaging	0.94
R5023:Ank2	UTSW	3	126941871	intron	probably benign
R5060:Ank2	UTSW	3	126945921	intron	probably benign
R5078:Ank2	UTSW	3	126942353	intron	probably benign
R5086:Ank2	UTSW	3	126947348	intron	probably benign
R5134:Ank2	UTSW	3	126963445	missense	possibly damaging	0.94
R5148:Ank2	UTSW	3	127025636	splice site	probably null
R5175:Ank2	UTSW	3	127004024	missense	probably damaging	1.00
R5275:Ank2	UTSW	3	127032183	missense	probably damaging	1.00
R5295:Ank2	UTSW	3	127032183	missense	probably damaging	1.00
R5303:Ank2	UTSW	3	126945804	intron	probably benign
R5309:Ank2	UTSW	3	126959768	missense	probably damaging	0.99
R5312:Ank2	UTSW	3	126959768	missense	probably damaging	0.99
R5352:Ank2	UTSW	3	127498991	utr 5 prime	probably benign
R5355:Ank2	UTSW	3	126944049	intron	probably benign
R5386:Ank2	UTSW	3	126981933	missense	probably benign	0.01
R5396:Ank2	UTSW	3	126953226	missense	probably damaging	1.00
R5518:Ank2	UTSW	3	126959699	missense	probably damaging	0.98
R5534:Ank2	UTSW	3	126947298	intron	probably benign
R5554:Ank2	UTSW	3	126998973	missense	possibly damaging	0.78
R5582:Ank2	UTSW	3	126946305	intron	probably benign
R5747:Ank2	UTSW	3	126941751	intron	probably benign
R5794:Ank2	UTSW	3	126930020	missense	probably benign	0.00
R5831:Ank2	UTSW	3	127339159	start gained	probably benign
R5925:Ank2	UTSW	3	126932963	missense	probably benign	0.18
R5954:Ank2	UTSW	3	126997861	missense	probably benign	0.34
R5956:Ank2	UTSW	3	126942688	intron	probably benign
R5986:Ank2	UTSW	3	127012686	missense	possibly damaging	0.94
R5992:Ank2	UTSW	3	126959651	critical splice donor site	probably null
R6020:Ank2	UTSW	3	126946821	intron	probably benign
R6027:Ank2	UTSW	3	126997879	missense	possibly damaging	0.92
R6049:Ank2	UTSW	3	126943020	missense	possibly damaging	0.95
R6060:Ank2	UTSW	3	126955952	missense	probably damaging	1.00
R6114:Ank2	UTSW	3	127011051	missense	probably damaging	1.00
R6124:Ank2	UTSW	3	127248151	missense	probably benign	0.31
R6156:Ank2	UTSW	3	126944237	missense	probably damaging	1.00
R6173:Ank2	UTSW	3	127052746	missense	probably damaging	1.00
R6176:Ank2	UTSW	3	126945471	missense	probably benign	0.05
R6184:Ank2	UTSW	3	126962398	missense	probably damaging	1.00
R6199:Ank2	UTSW	3	127004006	missense	probably damaging	1.00
R6241:Ank2	UTSW	3	127052748	missense	probably damaging	1.00
R6254:Ank2	UTSW	3	126941804	intron	probably benign
R6259:Ank2	UTSW	3	127016986	missense	probably benign	0.28
R6260:Ank2	UTSW	3	126943557	missense	probably benign
R6321:Ank2	UTSW	3	126946938	intron	probably benign
R6393:Ank2	UTSW	3	126929757	missense	probably damaging	1.00
R6406:Ank2	UTSW	3	127032225	missense	probably damaging	1.00
R6544:Ank2	UTSW	3	126933222	missense	probably damaging	0.99
R6583:Ank2	UTSW	3	127016964	missense	probably damaging	1.00
R6739:Ank2	UTSW	3	127079994	missense	probably damaging	1.00
R6754:Ank2	UTSW	3	127096839	intron	probably benign
R6786:Ank2	UTSW	3	126958932	missense	probably damaging	0.99
R6798:Ank2	UTSW	3	126944264	intron	probably benign
R6882:Ank2	UTSW	3	126945757	intron	probably benign
R6940:Ank2	UTSW	3	126941972	intron	probably benign
R6949:Ank2	UTSW	3	127010884	missense	probably benign	0.00
R7001:Ank2	UTSW	3	127077581	missense	probably damaging	1.00
R7033:Ank2	UTSW	3	126944850	nonsense	probably null
R7036:Ank2	UTSW	3	126946392	intron	probably benign
R7045:Ank2	UTSW	3	127012744	missense	probably damaging	1.00
R7048:Ank2	UTSW	3	127025618	missense	probably benign	0.03
R7054:Ank2	UTSW	3	126943303	intron	probably benign
R7069:Ank2	UTSW	3	126946298	intron	probably benign
R7091:Ank2	UTSW	3	127023351	missense	probably damaging	0.98
R7107:Ank2	UTSW	3	127003982	missense	probably damaging	1.00
R7175:Ank2	UTSW	3	126946941	missense	unknown
R7191:Ank2	UTSW	3	126946392	missense	unknown
R7272:Ank2	UTSW	3	126943133	missense	unknown
R7381:Ank2	UTSW	3	126936628	missense	possibly damaging	0.46
R7394:Ank2	UTSW	3	126936653	missense	possibly damaging	0.77
R7462:Ank2	UTSW	3	126943034	missense	unknown
R7490:Ank2	UTSW	3	126958889	missense	probably damaging	0.99
R7514:Ank2	UTSW	3	127025603	missense	probably benign	0.06
R7534:Ank2	UTSW	3	126934333	splice site	probably null
R7540:Ank2	UTSW	3	126988159	missense	possibly damaging	0.94
R7547:Ank2	UTSW	3	126945203	missense	unknown
R7579:Ank2	UTSW	3	126946398	missense	unknown
R7584:Ank2	UTSW	3	126946128	nonsense	probably null
R7625:Ank2	UTSW	3	127052800	missense	probably damaging	1.00
R7698:Ank2	UTSW	3	127032211	missense	probably benign	0.35
R7716:Ank2	UTSW	3	126943166	missense	unknown
R7718:Ank2	UTSW	3	126965013	missense	possibly damaging	0.88
R7722:Ank2	UTSW	3	127029302	missense	probably benign	0.01
R7738:Ank2	UTSW	3	126947622	missense
R7977:Ank2	UTSW	3	126945707	missense	unknown
R7987:Ank2	UTSW	3	126945707	missense	unknown
R8007:Ank2	UTSW	3	126936447	intron	probably benign
R8150:Ank2	UTSW	3	126947513	missense
R8161:Ank2	UTSW	3	127032129	missense
R8196:Ank2	UTSW	3	126929883	missense	probably damaging	0.99
R8248:Ank2	UTSW	3	126937785	missense	possibly damaging	0.78
R8255:Ank2	UTSW	3	126946749	missense	unknown
R8279:Ank2	UTSW	3	126933171	missense	probably benign	0.04
R8300:Ank2	UTSW	3	127010906	missense
R8716:Ank2	UTSW	3	126942839	nonsense	probably null
R8724:Ank2	UTSW	3	126943756	missense	unknown
R8765:Ank2	UTSW	3	127057082	missense	possibly damaging	0.94
R8779:Ank2	UTSW	3	126965102	missense	probably damaging	0.99
R8783:Ank2	UTSW	3	127052806	missense	probably damaging	1.00
R8785:Ank2	UTSW	3	126997921	missense	probably damaging	1.00
R8826:Ank2	UTSW	3	126947302	missense	unknown
R8872:Ank2	UTSW	3	126997876	missense	possibly damaging	0.88
R8903:Ank2	UTSW	3	127046782	missense	probably damaging	1.00
R8906:Ank2	UTSW	3	126933071	missense	probably benign	0.00
R8918:Ank2	UTSW	3	126943731	missense	unknown
R8947:Ank2	UTSW	3	126942747	intron	probably benign
R8977:Ank2	UTSW	3	126944926	missense	unknown
R8990:Ank2	UTSW	3	127048180	critical splice donor site	probably null
R8994:Ank2	UTSW	3	126929822	missense	probably benign	0.19
R9009:Ank2	UTSW	3	126934376	unclassified	probably benign
R9123:Ank2	UTSW	3	126940095	missense	probably damaging	1.00
R9125:Ank2	UTSW	3	126940095	missense	probably damaging	1.00
R9130:Ank2	UTSW	3	127016916	missense
R9175:Ank2	UTSW	3	126928753	missense	possibly damaging	0.52
R9220:Ank2	UTSW	3	126943437	missense	unknown
R9225:Ank2	UTSW	3	126942462	missense	unknown
R9286:Ank2	UTSW	3	127052732	missense	probably damaging	0.99
R9325:Ank2	UTSW	3	126981855	missense	probably damaging	0.98
R9367:Ank2	UTSW	3	126945029	missense	unknown
R9385:Ank2	UTSW	3	126959717	missense	probably benign	0.00
R9391:Ank2	UTSW	3	126937745	missense	probably damaging	0.99
R9422:Ank2	UTSW	3	127096856	missense	unknown
R9536:Ank2	UTSW	3	126942382	missense	unknown
R9647:Ank2	UTSW	3	126998974	missense	possibly damaging	0.93
R9650:Ank2	UTSW	3	126942180	missense	unknown
R9666:Ank2	UTSW	3	126933189	nonsense	probably null
R9686:Ank2	UTSW	3	126946901	missense	unknown
R9730:Ank2	UTSW	3	127225844	missense
R9738:Ank2	UTSW	3	126943472	missense	unknown
R9743:Ank2	UTSW	3	126940145	missense	possibly damaging	0.81
R9747:Ank2	UTSW	3	126959018	missense	probably damaging	1.00
R9800:Ank2	UTSW	3	126946500	missense	unknown
R9803:Ank2	UTSW	3	126959077	missense	possibly damaging	0.64
RF020:Ank2	UTSW	3	126945476	missense	unknown
Z1088:Ank2	UTSW	3	127029509	missense	possibly damaging	0.45
Z1177:Ank2	UTSW	3	126944357	missense	unknown
Z1187:Ank2	UTSW	3	126955952	missense	probably damaging	1.00
Z1190:Ank2	UTSW	3	126955952	missense	probably damaging	1.00
Z1192:Ank2	UTSW	3	126955952	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATCTTAAAGCAGTGCCTTATCCAC -3'
(R):5'- AGTGTCACTGTCCCACCATC -3'

Sequencing Primer
(F):5'- GCAGTGCCTTATCCACATGCC -3'
(R):5'- CATCTGGTAGTCACTGGGCTC -3'

Posted On

2016-04-15