Incidental Mutation 'R4937:Dmwd'
ID380469
Institutional Source Beutler Lab
Gene Symbol Dmwd
Ensembl Gene ENSMUSG00000030410
Gene Namedystrophia myotonica-containing WD repeat motif
SynonymsDm9, 59, DMR-N9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R4937 (G1)
Quality Score170
Status Not validated
Chromosome7
Chromosomal Location19076227-19082776 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 19081303 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032568] [ENSMUST00000032570] [ENSMUST00000032570] [ENSMUST00000108473] [ENSMUST00000108474] [ENSMUST00000108479] [ENSMUST00000108479] [ENSMUST00000108479] [ENSMUST00000108479] [ENSMUST00000122999] [ENSMUST00000154199]
Predicted Effect probably benign
Transcript: ENSMUST00000032568
SMART Domains Protein: ENSMUSP00000032568
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 6.5e-87 SMART
S_TK_X 340 407 3.6e-11 SMART
Pfam:DMPK_coil 472 532 2.8e-25 PFAM
low complexity region 590 613 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000032570
SMART Domains Protein: ENSMUSP00000032570
Gene: ENSMUSG00000030410

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 44 92 N/A INTRINSIC
WD40 203 239 4.11e1 SMART
WD40 270 309 3.5e-4 SMART
WD40 312 351 2.01e-4 SMART
WD40 354 436 8.36e-2 SMART
low complexity region 450 471 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
Blast:WD40 509 620 1e-43 BLAST
low complexity region 653 662 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000032570
SMART Domains Protein: ENSMUSP00000032570
Gene: ENSMUSG00000030410

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 44 92 N/A INTRINSIC
WD40 203 239 4.11e1 SMART
WD40 270 309 3.5e-4 SMART
WD40 312 351 2.01e-4 SMART
WD40 354 436 8.36e-2 SMART
low complexity region 450 471 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
Blast:WD40 509 620 1e-43 BLAST
low complexity region 653 662 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108473
SMART Domains Protein: ENSMUSP00000104113
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 407 7.5e-9 SMART
Pfam:DMPK_coil 472 532 2.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108474
SMART Domains Protein: ENSMUSP00000104114
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 336 2.57e-76 SMART
Pfam:DMPK_coil 446 506 2.4e-28 PFAM
low complexity region 564 587 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108479
SMART Domains Protein: ENSMUSP00000104119
Gene: ENSMUSG00000030410

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 44 92 N/A INTRINSIC
WD40 203 239 4.11e1 SMART
WD40 270 309 3.5e-4 SMART
WD40 312 351 2.01e-4 SMART
WD40 354 436 8.36e-2 SMART
low complexity region 450 471 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
Blast:WD40 509 620 1e-43 BLAST
low complexity region 628 637 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108479
SMART Domains Protein: ENSMUSP00000104119
Gene: ENSMUSG00000030410

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 44 92 N/A INTRINSIC
WD40 203 239 4.11e1 SMART
WD40 270 309 3.5e-4 SMART
WD40 312 351 2.01e-4 SMART
WD40 354 436 8.36e-2 SMART
low complexity region 450 471 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
Blast:WD40 509 620 1e-43 BLAST
low complexity region 628 637 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108479
SMART Domains Protein: ENSMUSP00000104119
Gene: ENSMUSG00000030410

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 44 92 N/A INTRINSIC
WD40 203 239 4.11e1 SMART
WD40 270 309 3.5e-4 SMART
WD40 312 351 2.01e-4 SMART
WD40 354 436 8.36e-2 SMART
low complexity region 450 471 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
Blast:WD40 509 620 1e-43 BLAST
low complexity region 628 637 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108479
SMART Domains Protein: ENSMUSP00000104119
Gene: ENSMUSG00000030410

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 44 92 N/A INTRINSIC
WD40 203 239 4.11e1 SMART
WD40 270 309 3.5e-4 SMART
WD40 312 351 2.01e-4 SMART
WD40 354 436 8.36e-2 SMART
low complexity region 450 471 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
Blast:WD40 509 620 1e-43 BLAST
low complexity region 628 637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122999
SMART Domains Protein: ENSMUSP00000123516
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
PDB:2VD5|B 32 139 3e-62 PDB
SCOP:d1koba_ 44 139 3e-21 SMART
Blast:S_TKc 71 139 7e-36 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149188
Predicted Effect probably benign
Transcript: ENSMUST00000154199
SMART Domains Protein: ENSMUSP00000118459
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 402 5.3e-9 SMART
Pfam:DMPK_coil 467 527 2.3e-28 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,736,201 F597S probably benign Het
4933406M09Rik T A 1: 134,389,976 M162K probably benign Het
Aasdh C A 5: 76,888,654 E347* probably null Het
Abca16 G T 7: 120,527,086 C1155F probably damaging Het
Adam26a T C 8: 43,568,881 D524G probably damaging Het
Adamts20 G C 15: 94,379,775 H269D probably benign Het
Akap9 T A 5: 4,050,145 probably null Het
Akt3 T C 1: 177,050,127 I358M possibly damaging Het
Aldh9a1 G T 1: 167,361,807 A375S probably damaging Het
Alg2 A G 4: 47,473,974 S105P probably benign Het
Amph A G 13: 19,104,345 T335A probably damaging Het
Ank2 C T 3: 126,962,401 V1056M probably damaging Het
Apoh A G 11: 108,407,378 D168G probably benign Het
Arfgef3 C T 10: 18,589,706 A2130T probably damaging Het
Arhgap30 A G 1: 171,403,329 D218G probably benign Het
Ascc3 C T 10: 50,823,798 P1906S probably damaging Het
Atp11b T G 3: 35,807,008 probably null Het
B4galnt2 A G 11: 95,868,429 V343A probably damaging Het
Barhl1 T C 2: 28,909,773 Y280C probably damaging Het
Bcar1 A T 8: 111,721,037 Y103N probably damaging Het
Bid A G 6: 120,895,746 I150T probably benign Het
Ccdc171 T C 4: 83,549,639 S74P probably damaging Het
Ccni A T 5: 93,188,254 probably null Het
Cct8l1 A G 5: 25,516,893 E202G probably benign Het
Cd200r3 A G 16: 44,954,259 K212E probably benign Het
Cdh19 A G 1: 110,889,964 S683P probably damaging Het
Ces2b A T 8: 104,832,781 H93L probably benign Het
Clec4a1 G A 6: 122,930,695 C114Y probably damaging Het
Dcc G T 18: 71,542,249 S636* probably null Het
Dcdc2c T C 12: 28,530,473 D187G possibly damaging Het
Dgkb G T 12: 38,114,658 E150* probably null Het
Dhx30 A G 9: 110,085,961 L884P probably damaging Het
Dnah17 T A 11: 118,042,154 N3593Y probably damaging Het
Dnm2 G A 9: 21,481,337 S447N probably benign Het
Elk4 G A 1: 132,017,681 G99D probably damaging Het
Entpd1 A T 19: 40,739,521 probably benign Het
Fam114a1 T A 5: 64,979,727 D4E probably damaging Het
Fam160b1 T C 19: 57,378,637 V204A probably benign Het
Fam166b T A 4: 43,427,514 Q270L possibly damaging Het
Fbln2 A G 6: 91,264,699 D754G probably damaging Het
Foxred2 T C 15: 77,955,835 N85S probably damaging Het
Fut9 A G 4: 25,799,591 probably benign Het
Gm13023 T C 4: 143,793,837 V53A possibly damaging Het
Gm13762 T A 2: 88,973,490 I134F probably damaging Het
Gm14124 C T 2: 150,268,760 H457Y unknown Het
Gm1818 G A 12: 48,559,824 noncoding transcript Het
Gm4894 C A 9: 49,278,700 Q92K unknown Het
Gpx2 T C 12: 76,792,800 I141M probably benign Het
Gusb T C 5: 129,995,485 T476A probably damaging Het
Hmmr G A 11: 40,721,840 T180I possibly damaging Het
Itgbl1 T C 14: 123,973,368 Y493H probably benign Het
Klhdc9 G T 1: 171,360,383 C93* probably null Het
Lpar3 A G 3: 146,284,751 K275E probably damaging Het
Lrp1b A G 2: 40,802,885 probably null Het
Lrrc63 C T 14: 75,084,949 G572S probably damaging Het
Mapk11 A T 15: 89,146,482 D98E probably benign Het
Net1 G A 13: 3,884,905 R374W probably damaging Het
Nlrp4g T A 9: 124,354,005 noncoding transcript Het
Nrap T A 19: 56,347,220 Y923F probably damaging Het
Olfr53 T A 7: 140,652,621 M214K probably benign Het
Olfr811 A T 10: 129,802,063 V154E probably benign Het
Plxnc1 A G 10: 94,841,473 V964A probably damaging Het
Pmfbp1 A G 8: 109,535,866 I731V probably benign Het
Polq T A 16: 37,027,912 S294T probably benign Het
Pomgnt2 T C 9: 121,982,554 D387G probably benign Het
Prmt2 G A 10: 76,221,008 T227I probably damaging Het
Psmd1 T A 1: 86,083,225 F341I probably damaging Het
Ptpn23 T C 9: 110,392,738 M127V probably benign Het
Ptprc A G 1: 138,089,500 F483L probably damaging Het
Rab35 A C 5: 115,640,088 I38L probably damaging Het
Rapgef6 A G 11: 54,657,317 T486A probably damaging Het
Rgl3 A T 9: 21,987,708 C68* probably null Het
Rilpl1 T C 5: 124,515,531 E189G possibly damaging Het
Rnf217 T C 10: 31,517,524 I354V probably benign Het
Rspo3 T C 10: 29,506,528 D50G probably damaging Het
Sbno1 A G 5: 124,374,609 S1366P possibly damaging Het
Sema3c A G 5: 17,694,686 D392G probably benign Het
Serpinb9e A T 13: 33,252,952 Y85F probably benign Het
Shprh C T 10: 11,157,119 T283I probably benign Het
Sipa1l1 T C 12: 82,341,329 S110P probably benign Het
Slc16a12 T A 19: 34,675,243 I168F probably damaging Het
Slc23a3 A G 1: 75,132,624 S221P probably damaging Het
Slc35b3 A T 13: 38,932,911 I366K possibly damaging Het
Slc44a5 T C 3: 154,243,615 probably null Het
Slc5a12 A T 2: 110,620,408 D316V probably damaging Het
Ssr3 A G 3: 65,392,453 S29P probably damaging Het
Taf2 G A 15: 55,027,223 Q1055* probably null Het
Them6 A T 15: 74,721,518 D75V probably damaging Het
Tmem159 T C 7: 120,116,312 S120P probably damaging Het
Tom1l2 A G 11: 60,258,918 S239P probably damaging Het
Tspear A G 10: 77,875,043 T500A probably damaging Het
Tubgcp6 G A 15: 89,101,549 A1487V probably damaging Het
Uba7 G A 9: 107,978,991 V522I possibly damaging Het
Virma C A 4: 11,521,147 C901* probably null Het
Vmn1r172 A T 7: 23,659,887 I66F possibly damaging Het
Vmn2r82 A T 10: 79,379,176 Y331F probably benign Het
Wdr55 G A 18: 36,762,398 V143I probably benign Het
Zbtb49 A T 5: 38,213,963 D191E possibly damaging Het
Zfhx4 A G 3: 5,242,011 H99R probably damaging Het
Zfp560 C T 9: 20,347,967 C533Y probably damaging Het
Zfp646 C T 7: 127,879,182 A177V probably benign Het
Zfp653 C T 9: 22,055,778 E604K probably damaging Het
Other mutations in Dmwd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Dmwd APN 7 19081234 unclassified probably null
IGL01668:Dmwd APN 7 19081155 missense probably damaging 1.00
IGL02705:Dmwd APN 7 19080844 missense probably benign 0.02
IGL03036:Dmwd APN 7 19081129 missense probably damaging 1.00
IGL03133:Dmwd APN 7 19076637 missense probably damaging 1.00
PIT4305001:Dmwd UTSW 7 19080718 missense probably damaging 0.99
R0172:Dmwd UTSW 7 19080342 missense probably damaging 1.00
R1619:Dmwd UTSW 7 19081034 unclassified probably benign
R2055:Dmwd UTSW 7 19076685 missense probably benign 0.34
R2058:Dmwd UTSW 7 19080727 missense probably damaging 1.00
R2403:Dmwd UTSW 7 19081159 missense possibly damaging 0.94
R2922:Dmwd UTSW 7 19076345 missense probably damaging 1.00
R3122:Dmwd UTSW 7 19080695 missense probably damaging 1.00
R4876:Dmwd UTSW 7 19080547 missense probably damaging 1.00
R5018:Dmwd UTSW 7 19078119 missense probably damaging 0.99
R5034:Dmwd UTSW 7 19080294 missense probably damaging 1.00
R5165:Dmwd UTSW 7 19078035 intron probably benign
R5265:Dmwd UTSW 7 19080281 missense possibly damaging 0.89
R5559:Dmwd UTSW 7 19080438 missense probably damaging 0.99
R6695:Dmwd UTSW 7 19080727 missense probably damaging 1.00
R7106:Dmwd UTSW 7 19080529 missense probably damaging 1.00
R7208:Dmwd UTSW 7 19080309 missense probably benign 0.05
R7681:Dmwd UTSW 7 19081082 missense probably benign 0.23
R7683:Dmwd UTSW 7 19080735 missense probably damaging 1.00
R7760:Dmwd UTSW 7 19080735 missense probably damaging 1.00
R7763:Dmwd UTSW 7 19080340 missense probably damaging 1.00
R7814:Dmwd UTSW 7 19080843 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAATGACAAGCTCAGTGGTCC -3'
(R):5'- TCTGCCTTGAGTGTGAAGTACTAAG -3'

Sequencing Primer
(F):5'- ATTGGACCCAGCTAAGGTGC -3'
(R):5'- TGTGAAGTACTAAGGATGAGCC -3'
Posted On2016-04-15