Incidental Mutation 'R4937:Dnm2'
ID380481
Institutional Source Beutler Lab
Gene Symbol Dnm2
Ensembl Gene ENSMUSG00000033335
Gene Namedynamin 2
Synonymsb2b2159Clo, Dyn2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4937 (G1)
Quality Score171
Status Not validated
Chromosome9
Chromosomal Location21424908-21507759 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 21481337 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 447 (S447N)
Ref Sequence ENSEMBL: ENSMUSP00000133564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072362] [ENSMUST00000091087] [ENSMUST00000115404] [ENSMUST00000165766] [ENSMUST00000172482] [ENSMUST00000173397]
Predicted Effect probably benign
Transcript: ENSMUST00000072362
AA Change: S447N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000072199
Gene: ENSMUSG00000033335
AA Change: S447N

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091087
AA Change: S447N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000088616
Gene: ENSMUSG00000033335
AA Change: S447N

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 516 623 8e-13 SMART
GED 644 735 2.57e-28 SMART
low complexity region 736 748 N/A INTRINSIC
low complexity region 773 795 N/A INTRINSIC
low complexity region 827 860 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115404
AA Change: S447N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111063
Gene: ENSMUSG00000033335
AA Change: S447N

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165766
AA Change: S447N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128961
Gene: ENSMUSG00000033335
AA Change: S447N

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 858 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169194
Predicted Effect probably benign
Transcript: ENSMUST00000172482
AA Change: S447N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133564
Gene: ENSMUSG00000033335
AA Change: S447N

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172763
Predicted Effect unknown
Transcript: ENSMUST00000172833
AA Change: S109N
SMART Domains Protein: ENSMUSP00000133858
Gene: ENSMUSG00000033335
AA Change: S109N

DomainStartEndE-ValueType
Pfam:Dynamin_M 1 163 2.4e-55 PFAM
Pfam:PH 193 248 2.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173397
AA Change: S447N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134243
Gene: ENSMUSG00000033335
AA Change: S447N

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 863 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000174050
AA Change: S397N
SMART Domains Protein: ENSMUSP00000134696
Gene: ENSMUSG00000033335
AA Change: S397N

DomainStartEndE-ValueType
DYNc 1 196 8.6e-138 SMART
low complexity region 249 264 N/A INTRINSIC
PH 467 574 8e-13 SMART
GED 595 686 2.57e-28 SMART
low complexity region 687 699 N/A INTRINSIC
low complexity region 724 746 N/A INTRINSIC
low complexity region 778 805 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dynamins represent one of the subfamilies of GTP-binding proteins. These proteins share considerable sequence similarity over the N-terminal portion of the molecule, which contains the GTPase domain. Dynamins are associated with microtubules. They have been implicated in cell processes such as endocytosis and cell motility, and in alterations of the membrane that accompany certain activities such as bone resorption by osteoclasts. Dynamins bind many proteins that bind actin and other cytoskeletal proteins. Dynamins can also self-assemble, a process that stimulates GTPase activity. Five alternatively spliced transcripts encoding different proteins have been described. Additional alternatively spliced transcripts may exist, but their full-length nature has not been determined. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted allele die prior to E8-E12. Mice heterozygous for a knock-out allele exhibit muscle atrophy and weakness, intermyofibrillar disorganization, and centrally localized mitochondria and sarcoplasmic reticulum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,736,201 F597S probably benign Het
4933406M09Rik T A 1: 134,389,976 M162K probably benign Het
Aasdh C A 5: 76,888,654 E347* probably null Het
Abca16 G T 7: 120,527,086 C1155F probably damaging Het
Adam26a T C 8: 43,568,881 D524G probably damaging Het
Adamts20 G C 15: 94,379,775 H269D probably benign Het
Akap9 T A 5: 4,050,145 probably null Het
Akt3 T C 1: 177,050,127 I358M possibly damaging Het
Aldh9a1 G T 1: 167,361,807 A375S probably damaging Het
Alg2 A G 4: 47,473,974 S105P probably benign Het
Amph A G 13: 19,104,345 T335A probably damaging Het
Ank2 C T 3: 126,962,401 V1056M probably damaging Het
Apoh A G 11: 108,407,378 D168G probably benign Het
Arfgef3 C T 10: 18,589,706 A2130T probably damaging Het
Arhgap30 A G 1: 171,403,329 D218G probably benign Het
Ascc3 C T 10: 50,823,798 P1906S probably damaging Het
Atp11b T G 3: 35,807,008 probably null Het
B4galnt2 A G 11: 95,868,429 V343A probably damaging Het
Barhl1 T C 2: 28,909,773 Y280C probably damaging Het
Bcar1 A T 8: 111,721,037 Y103N probably damaging Het
Bid A G 6: 120,895,746 I150T probably benign Het
Ccdc171 T C 4: 83,549,639 S74P probably damaging Het
Ccni A T 5: 93,188,254 probably null Het
Cct8l1 A G 5: 25,516,893 E202G probably benign Het
Cd200r3 A G 16: 44,954,259 K212E probably benign Het
Cdh19 A G 1: 110,889,964 S683P probably damaging Het
Ces2b A T 8: 104,832,781 H93L probably benign Het
Clec4a1 G A 6: 122,930,695 C114Y probably damaging Het
Dcc G T 18: 71,542,249 S636* probably null Het
Dcdc2c T C 12: 28,530,473 D187G possibly damaging Het
Dgkb G T 12: 38,114,658 E150* probably null Het
Dhx30 A G 9: 110,085,961 L884P probably damaging Het
Dmwd T G 7: 19,081,303 probably null Het
Dnah17 T A 11: 118,042,154 N3593Y probably damaging Het
Elk4 G A 1: 132,017,681 G99D probably damaging Het
Entpd1 A T 19: 40,739,521 probably benign Het
Fam114a1 T A 5: 64,979,727 D4E probably damaging Het
Fam160b1 T C 19: 57,378,637 V204A probably benign Het
Fam166b T A 4: 43,427,514 Q270L possibly damaging Het
Fbln2 A G 6: 91,264,699 D754G probably damaging Het
Foxred2 T C 15: 77,955,835 N85S probably damaging Het
Fut9 A G 4: 25,799,591 probably benign Het
Gm13023 T C 4: 143,793,837 V53A possibly damaging Het
Gm13762 T A 2: 88,973,490 I134F probably damaging Het
Gm14124 C T 2: 150,268,760 H457Y unknown Het
Gm1818 G A 12: 48,559,824 noncoding transcript Het
Gm4894 C A 9: 49,278,700 Q92K unknown Het
Gpx2 T C 12: 76,792,800 I141M probably benign Het
Gusb T C 5: 129,995,485 T476A probably damaging Het
Hmmr G A 11: 40,721,840 T180I possibly damaging Het
Itgbl1 T C 14: 123,973,368 Y493H probably benign Het
Klhdc9 G T 1: 171,360,383 C93* probably null Het
Lpar3 A G 3: 146,284,751 K275E probably damaging Het
Lrp1b A G 2: 40,802,885 probably null Het
Lrrc63 C T 14: 75,084,949 G572S probably damaging Het
Mapk11 A T 15: 89,146,482 D98E probably benign Het
Net1 G A 13: 3,884,905 R374W probably damaging Het
Nlrp4g T A 9: 124,354,005 noncoding transcript Het
Nrap T A 19: 56,347,220 Y923F probably damaging Het
Olfr53 T A 7: 140,652,621 M214K probably benign Het
Olfr811 A T 10: 129,802,063 V154E probably benign Het
Plxnc1 A G 10: 94,841,473 V964A probably damaging Het
Pmfbp1 A G 8: 109,535,866 I731V probably benign Het
Polq T A 16: 37,027,912 S294T probably benign Het
Pomgnt2 T C 9: 121,982,554 D387G probably benign Het
Prmt2 G A 10: 76,221,008 T227I probably damaging Het
Psmd1 T A 1: 86,083,225 F341I probably damaging Het
Ptpn23 T C 9: 110,392,738 M127V probably benign Het
Ptprc A G 1: 138,089,500 F483L probably damaging Het
Rab35 A C 5: 115,640,088 I38L probably damaging Het
Rapgef6 A G 11: 54,657,317 T486A probably damaging Het
Rgl3 A T 9: 21,987,708 C68* probably null Het
Rilpl1 T C 5: 124,515,531 E189G possibly damaging Het
Rnf217 T C 10: 31,517,524 I354V probably benign Het
Rspo3 T C 10: 29,506,528 D50G probably damaging Het
Sbno1 A G 5: 124,374,609 S1366P possibly damaging Het
Sema3c A G 5: 17,694,686 D392G probably benign Het
Serpinb9e A T 13: 33,252,952 Y85F probably benign Het
Shprh C T 10: 11,157,119 T283I probably benign Het
Sipa1l1 T C 12: 82,341,329 S110P probably benign Het
Slc16a12 T A 19: 34,675,243 I168F probably damaging Het
Slc23a3 A G 1: 75,132,624 S221P probably damaging Het
Slc35b3 A T 13: 38,932,911 I366K possibly damaging Het
Slc44a5 T C 3: 154,243,615 probably null Het
Slc5a12 A T 2: 110,620,408 D316V probably damaging Het
Ssr3 A G 3: 65,392,453 S29P probably damaging Het
Taf2 G A 15: 55,027,223 Q1055* probably null Het
Them6 A T 15: 74,721,518 D75V probably damaging Het
Tmem159 T C 7: 120,116,312 S120P probably damaging Het
Tom1l2 A G 11: 60,258,918 S239P probably damaging Het
Tspear A G 10: 77,875,043 T500A probably damaging Het
Tubgcp6 G A 15: 89,101,549 A1487V probably damaging Het
Uba7 G A 9: 107,978,991 V522I possibly damaging Het
Virma C A 4: 11,521,147 C901* probably null Het
Vmn1r172 A T 7: 23,659,887 I66F possibly damaging Het
Vmn2r82 A T 10: 79,379,176 Y331F probably benign Het
Wdr55 G A 18: 36,762,398 V143I probably benign Het
Zbtb49 A T 5: 38,213,963 D191E possibly damaging Het
Zfhx4 A G 3: 5,242,011 H99R probably damaging Het
Zfp560 C T 9: 20,347,967 C533Y probably damaging Het
Zfp646 C T 7: 127,879,182 A177V probably benign Het
Zfp653 C T 9: 22,055,778 E604K probably damaging Het
Other mutations in Dnm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01446:Dnm2 APN 9 21481376 missense probably damaging 1.00
IGL01757:Dnm2 APN 9 21465619 missense probably damaging 1.00
IGL02142:Dnm2 APN 9 21500353 missense probably damaging 1.00
IGL02195:Dnm2 APN 9 21425249 missense probably damaging 1.00
IGL02472:Dnm2 APN 9 21485708 missense possibly damaging 0.55
IGL03161:Dnm2 APN 9 21485724 splice site probably benign
IGL03392:Dnm2 APN 9 21474611 missense probably damaging 1.00
R0302:Dnm2 UTSW 9 21500343 missense probably benign 0.27
R0743:Dnm2 UTSW 9 21500265 missense probably damaging 1.00
R0945:Dnm2 UTSW 9 21505660 missense probably damaging 0.97
R1629:Dnm2 UTSW 9 21504458 missense probably damaging 1.00
R1678:Dnm2 UTSW 9 21467532 missense possibly damaging 0.89
R1848:Dnm2 UTSW 9 21505681 missense possibly damaging 0.87
R2084:Dnm2 UTSW 9 21500371 critical splice donor site probably null
R2214:Dnm2 UTSW 9 21485723 critical splice donor site probably null
R2346:Dnm2 UTSW 9 21467556 missense probably damaging 1.00
R3711:Dnm2 UTSW 9 21506373 unclassified probably benign
R3796:Dnm2 UTSW 9 21505487 missense probably benign
R4017:Dnm2 UTSW 9 21494604 missense probably damaging 1.00
R4432:Dnm2 UTSW 9 21491304 intron probably benign
R4583:Dnm2 UTSW 9 21504446 missense probably damaging 1.00
R4604:Dnm2 UTSW 9 21504664 critical splice donor site probably null
R4735:Dnm2 UTSW 9 21474587 missense probably damaging 0.99
R4803:Dnm2 UTSW 9 21474629 missense probably damaging 1.00
R4832:Dnm2 UTSW 9 21474679 splice site probably null
R4836:Dnm2 UTSW 9 21491330 intron probably benign
R4948:Dnm2 UTSW 9 21504533 missense possibly damaging 0.90
R5059:Dnm2 UTSW 9 21504578 missense probably damaging 1.00
R5291:Dnm2 UTSW 9 21478907 missense probably damaging 1.00
R5538:Dnm2 UTSW 9 21505627 missense probably benign 0.05
R5613:Dnm2 UTSW 9 21472667 missense probably damaging 1.00
R5805:Dnm2 UTSW 9 21467669 missense probably damaging 0.97
R6253:Dnm2 UTSW 9 21500275 missense probably damaging 1.00
R6586:Dnm2 UTSW 9 21505646 missense probably benign 0.32
R6826:Dnm2 UTSW 9 21504471 nonsense probably null
R6855:Dnm2 UTSW 9 21476585 missense probably damaging 1.00
R7121:Dnm2 UTSW 9 21474566 missense probably benign 0.31
R7307:Dnm2 UTSW 9 21485687 missense probably damaging 1.00
R7318:Dnm2 UTSW 9 21505567 missense possibly damaging 0.46
R7467:Dnm2 UTSW 9 21481376 missense probably damaging 1.00
R7619:Dnm2 UTSW 9 21505634 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGGGTAGTAAGTGTCATTCAC -3'
(R):5'- CTGACTAATTTATTTGGAAGCCAGG -3'

Sequencing Primer
(F):5'- GCCACTTTCCACCTCCAATCG -3'
(R):5'- TATTTGGAAGCCAGGTTGAGTTAAAG -3'
Posted On2016-04-15